Transcript: Mouse XM_006527613.3

PREDICTED: Mus musculus nyctalopin (Nyx), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nyx (236690)
Length:
5256
CDS:
1844..3274

Additional Resources:

NCBI RefSeq record:
XM_006527613.3
NBCI Gene record:
Nyx (236690)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527613.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250731 TCTGCTACAAGGCCACGTTTC pLKO_005 3189 CDS 100% 6.000 4.800 N Nyx n/a
2 TRCN0000200912 CCACAATTGATCCCTCAGTAT pLKO.1 4356 3UTR 100% 4.950 3.960 N Nyx n/a
3 TRCN0000216978 CCCTGATGAACTGAACTTTAC pLKO.1 2992 CDS 100% 10.800 7.560 N Nyx n/a
4 TRCN0000250732 CCCTGATGAACTGAACTTTAC pLKO_005 2992 CDS 100% 10.800 7.560 N Nyx n/a
5 TRCN0000250730 CTGTGGAGGAGGTAGCCAATA pLKO_005 3105 CDS 100% 10.800 7.560 N Nyx n/a
6 TRCN0000250733 ACCGCAACAGCATCACCTTTG pLKO_005 2685 CDS 100% 6.000 4.200 N Nyx n/a
7 TRCN0000201151 CCACAATAACCTGTCCTTCAT pLKO.1 2110 CDS 100% 4.950 3.465 N Nyx n/a
8 TRCN0000258071 AGGAATGGGATTGGTAGTTAA pLKO_005 3370 3UTR 100% 13.200 7.920 N Nyx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527613.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03892 pDONR223 100% 83.8% 83.7% None (many diffs) n/a
2 ccsbBroad304_03892 pLX_304 0% 83.8% 83.7% V5 (many diffs) n/a
3 TRCN0000468575 GCGTCTTTTTCTTATGCCGTTGCA pLX_317 21.2% 83.8% 83.7% V5 (many diffs) n/a
Download CSV