Transcript: Mouse XM_006527731.3

PREDICTED: Mus musculus plastin 3 (T-isoform) (Pls3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pls3 (102866)
Length:
3286
CDS:
248..2179

Additional Resources:

NCBI RefSeq record:
XM_006527731.3
NBCI Gene record:
Pls3 (102866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090325 CGGATATAAAGTGAGAGAAAT pLKO.1 406 CDS 100% 13.200 18.480 N Pls3 n/a
2 TRCN0000323902 CGGATATAAAGTGAGAGAAAT pLKO_005 406 CDS 100% 13.200 18.480 N Pls3 n/a
3 TRCN0000090326 GCCGAAAGTATGCTTCAACAA pLKO.1 1295 CDS 100% 4.950 6.930 N Pls3 n/a
4 TRCN0000323834 GCCGAAAGTATGCTTCAACAA pLKO_005 1295 CDS 100% 4.950 6.930 N Pls3 n/a
5 TRCN0000090327 GCTCAATCAAATCGCACCGAA pLKO.1 1201 CDS 100% 2.640 3.696 N Pls3 n/a
6 TRCN0000323833 GCTCAATCAAATCGCACCGAA pLKO_005 1201 CDS 100% 2.640 3.696 N Pls3 n/a
7 TRCN0000090324 CCGGATATAAAGTGAGAGAAA pLKO.1 405 CDS 100% 4.950 3.465 N Pls3 n/a
8 TRCN0000090323 GCTCAGAATTTAGACGGGAAT pLKO.1 3038 3UTR 100% 4.050 2.835 N Pls3 n/a
9 TRCN0000323903 GCTCAGAATTTAGACGGGAAT pLKO_005 3038 3UTR 100% 4.050 2.835 N Pls3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01223 pDONR223 100% 88.9% 97% None (many diffs) n/a
2 ccsbBroad304_01223 pLX_304 0% 88.9% 97% V5 (many diffs) n/a
3 TRCN0000470736 AATTCCACACCCAGCAGGCGCCAC pLX_317 23.2% 88.9% 97% V5 (many diffs) n/a
Download CSV