Transcript: Mouse XM_006527783.3

PREDICTED: Mus musculus plexin B3 (Plxnb3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plxnb3 (140571)
Length:
6056
CDS:
214..5796

Additional Resources:

NCBI RefSeq record:
XM_006527783.3
NBCI Gene record:
Plxnb3 (140571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527783.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250627 ACATCCCGTTGCGTCACTTTG pLKO_005 1243 CDS 100% 10.800 15.120 N Plxnb3 n/a
2 TRCN0000265263 ATTGCTGTTAAGTACCTATTT pLKO_005 5233 CDS 100% 13.200 9.240 N Plxnb3 n/a
3 TRCN0000250624 CAACCACATCCACAGGTATTA pLKO_005 5664 CDS 100% 13.200 9.240 N Plxnb3 n/a
4 TRCN0000173778 CCTGAGACCTGCCAACTTATA pLKO.1 5816 3UTR 100% 13.200 9.240 N Plxnb3 n/a
5 TRCN0000250626 CCTGAGACCTGCCAACTTATA pLKO_005 5816 3UTR 100% 13.200 9.240 N Plxnb3 n/a
6 TRCN0000250625 AGAAGTACTATGCGGACATTC pLKO_005 5537 CDS 100% 10.800 7.560 N Plxnb3 n/a
7 TRCN0000215924 CTATCTTACTCGCTTACTTTC pLKO.1 5139 CDS 100% 10.800 7.560 N Plxnb3 n/a
8 TRCN0000048221 CCACAGCTCATCTTTGATGTA pLKO.1 5365 CDS 100% 4.950 3.465 N PLXNB3 n/a
9 TRCN0000048220 CCCAGTGAACAAACTGCTCTA pLKO.1 5481 CDS 100% 4.050 2.430 N PLXNB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527783.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.