Transcript: Mouse XM_006527789.4

PREDICTED: Mus musculus coagulation factor VIII (F8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
F8 (14069)
Length:
12067
CDS:
2603..9556

Additional Resources:

NCBI RefSeq record:
XM_006527789.4
NBCI Gene record:
F8 (14069)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527789.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109482 CGACTCTTATACACAGTCTAT pLKO.1 3301 CDS 100% 4.950 6.930 N F8 n/a
2 TRCN0000109481 CCTCCAATTATTGCTCGATAT pLKO.1 8987 CDS 100% 10.800 7.560 N F8 n/a
3 TRCN0000109483 GCTCCTTTAGTCAGCCCTTAT pLKO.1 7788 CDS 100% 10.800 7.560 N F8 n/a
4 TRCN0000109480 CCGCTATTATTCAAGTTTCAT pLKO.1 4249 CDS 100% 5.625 3.938 N F8 n/a
5 TRCN0000109484 CCACCATTACTCACTCGCTAT pLKO.1 9452 CDS 100% 4.050 2.835 N F8 n/a
6 TRCN0000197533 CCTGATGACTAAGCATTCAAA pLKO.1 9928 3UTR 100% 5.625 2.813 Y Adprh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527789.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00530 pDONR223 100% 7.9% 7.6% None (many diffs) n/a
2 ccsbBroad304_00530 pLX_304 0% 7.9% 7.6% V5 (many diffs) n/a
3 TRCN0000475423 ACTACCGAGTTATGGTGGCGTCAC pLX_317 55.8% 7.9% 7.6% V5 (many diffs) n/a
Download CSV