Transcript: Mouse XM_006527869.2

PREDICTED: Mus musculus arrestin 3, retinal (Arr3), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arr3 (170735)
Length:
2019
CDS:
80..1453

Additional Resources:

NCBI RefSeq record:
XM_006527869.2
NBCI Gene record:
Arr3 (170735)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527869.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445624 TAACCTGCCCTGTTCAGTAAC pLKO_005 571 CDS 100% 10.800 15.120 N Arr3 n/a
2 TRCN0000416583 TTTCGCTATGGCCGTGATGAC pLKO_005 386 CDS 100% 4.050 5.670 N Arr3 n/a
3 TRCN0000412919 CATAGTCATCGAAGAGTTTAT pLKO_005 1405 CDS 100% 13.200 10.560 N Arr3 n/a
4 TRCN0000446817 GATGGACAGGGAGGTTCATTA pLKO_005 814 CDS 100% 13.200 10.560 N Arr3 n/a
5 TRCN0000109369 CGCAAAGATCTCTATGTACAA pLKO.1 431 CDS 100% 4.950 3.960 N Arr3 n/a
6 TRCN0000109365 CCACAGATGTTGTCCTGTATT pLKO.1 1035 CDS 100% 13.200 9.240 N Arr3 n/a
7 TRCN0000427278 GAGTACTTAGAAGGTCGAAAG pLKO_005 338 CDS 100% 6.000 4.200 N Arr3 n/a
8 TRCN0000152164 CCTGTATTCACTAGACAAGTA pLKO.1 1048 CDS 100% 4.950 3.465 N ARR3 n/a
9 TRCN0000109366 CGTGATCTTGATCCATCCAAA pLKO.1 1342 CDS 100% 4.950 3.465 N Arr3 n/a
10 TRCN0000109367 GCACAATTCTTCGACCTGGAA pLKO.1 1230 CDS 100% 2.640 1.848 N Arr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527869.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13815 pDONR223 100% 64.7% 63.4% None (many diffs) n/a
2 ccsbBroad304_13815 pLX_304 0% 64.7% 63.4% V5 (many diffs) n/a
3 TRCN0000479490 AACCCCACGGACCGCCCTGATTCG pLX_317 36.1% 64.7% 63.4% V5 (many diffs) n/a
Download CSV