Transcript: Mouse XM_006527926.3

PREDICTED: Mus musculus proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (Prrg3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prrg3 (208748)
Length:
6053
CDS:
220..915

Additional Resources:

NCBI RefSeq record:
XM_006527926.3
NBCI Gene record:
Prrg3 (208748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252397 AGAGCTCAGATGCTATGTATG pLKO_005 443 CDS 100% 10.800 15.120 N Prrg3 n/a
2 TRCN0000252401 ATGGCTGATGGAGCTAATATT pLKO_005 2591 3UTR 100% 15.000 10.500 N Prrg3 n/a
3 TRCN0000252399 GAAGAGGTCAAGGAAGTATTT pLKO_005 349 CDS 100% 13.200 9.240 N Prrg3 n/a
4 TRCN0000252398 ATGCCCATGCAGTCCTGAAAC pLKO_005 245 CDS 100% 10.800 7.560 N Prrg3 n/a
5 TRCN0000252400 TAGTCTTGCTGATTGTCATTG pLKO_005 485 CDS 100% 10.800 7.560 N Prrg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08914 pDONR223 100% 87.1% 93.9% None (many diffs) n/a
2 ccsbBroad304_08914 pLX_304 0% 87.1% 93.9% V5 (many diffs) n/a
3 TRCN0000480098 AACAACTCCGTTTAAACTAGGCGA pLX_317 50.5% 87.1% 93.9% V5 (many diffs) n/a
Download CSV