Transcript: Mouse XM_006527966.3

PREDICTED: Mus musculus zinc finger protein X-linked (Zfx), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfx (22764)
Length:
6931
CDS:
367..2766

Additional Resources:

NCBI RefSeq record:
XM_006527966.3
NBCI Gene record:
Zfx (22764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095620 ACAGAAATTGACCCTTGTAAA pLKO.1 1057 CDS 100% 13.200 18.480 N Zfx n/a
2 TRCN0000095619 GCCCAGAGTTAATAAAGTAAT pLKO.1 6704 3UTR 100% 13.200 18.480 N Zfx n/a
3 TRCN0000095623 GACTGACTATGGACAACGAAA pLKO.1 1037 CDS 100% 4.950 6.930 N Zfx n/a
4 TRCN0000095621 CGGTAATAATTCTGATGGAAT pLKO.1 1440 CDS 100% 4.950 2.970 N Zfx n/a
5 TRCN0000096494 CCTGATTCTATACTGAAGTTT pLKO.1 3005 3UTR 100% 5.625 2.813 Y Zfa-ps n/a
6 TRCN0000095622 GCCTATTGAATCGCCATCTTT pLKO.1 1943 CDS 100% 5.625 2.813 Y Zfx n/a
7 TRCN0000221679 AGTGATTTGAAACGACACATA pLKO.1 2284 CDS 100% 4.950 2.475 Y ZFX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01791 pDONR223 100% 81.2% 83.3% None (many diffs) n/a
2 TRCN0000477192 CGGTAAATAATATAGGTCCGTATT pLX_317 20.2% 81.2% 83.3% V5 (many diffs) n/a
Download CSV