Transcript: Mouse XM_006528048.2

PREDICTED: Mus musculus B cell receptor associated protein 31 (Bcap31), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcap31 (27061)
Length:
1397
CDS:
281..1018

Additional Resources:

NCBI RefSeq record:
XM_006528048.2
NBCI Gene record:
Bcap31 (27061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012422 CGAGAGATCCTGAAATACGAT pLKO.1 482 CDS 100% 3.000 2.400 N Bcap31 n/a
2 TRCN0000278146 CGAGAGATCCTGAAATACGAT pLKO_005 482 CDS 100% 3.000 2.400 N Bcap31 n/a
3 TRCN0000012419 GCCTCCAATGAAGCCTTTAAA pLKO.1 671 CDS 100% 15.000 10.500 N Bcap31 n/a
4 TRCN0000278073 GCCTCCAATGAAGCCTTTAAA pLKO_005 671 CDS 100% 15.000 10.500 N Bcap31 n/a
5 TRCN0000012420 GCTCAGAGGAATCTCTATATT pLKO.1 575 CDS 100% 15.000 10.500 N Bcap31 n/a
6 TRCN0000278071 GCTCAGAGGAATCTCTATATT pLKO_005 575 CDS 100% 15.000 10.500 N Bcap31 n/a
7 TRCN0000012418 CCATGGCTTATAGATCATTAT pLKO.1 1136 3UTR 100% 13.200 9.240 N Bcap31 n/a
8 TRCN0000278072 CCATGGCTTATAGATCATTAT pLKO_005 1136 3UTR 100% 13.200 9.240 N Bcap31 n/a
9 TRCN0000012421 CCTGAAGAATGACCTGAGGAA pLKO.1 826 CDS 100% 2.640 1.848 N Bcap31 n/a
10 TRCN0000278074 CCTGAAGAATGACCTGAGGAA pLKO_005 826 CDS 100% 2.640 1.848 N Bcap31 n/a
11 TRCN0000242710 GACGCCTGGTGACTCTCATTT pLKO_005 630 CDS 100% 13.200 9.240 N BCAP31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02326 pDONR223 100% 88.3% 90.6% None (many diffs) n/a
2 ccsbBroad304_02326 pLX_304 0% 88.3% 90.6% V5 (many diffs) n/a
3 TRCN0000481258 GAGCAGAGCGCCCAGACGTTGTCA pLX_317 51.9% 88.3% 90.6% V5 (many diffs) n/a
4 ccsbBroadEn_15694 pDONR223 0% 88.2% 90.2% None (many diffs) n/a
5 ccsbBroad304_15694 pLX_304 0% 88.2% 90.2% V5 (many diffs) n/a
6 TRCN0000474561 AACAGTTCAGGTCACCGGCGTCGC pLX_317 64.2% 88.2% 90.2% V5 (many diffs) n/a
Download CSV