Construct: ORF TRCN0000481258
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002708.1_s317c1
- Derived from:
- ccsbBroadEn_02326
- DNA Barcode:
- GAGCAGAGCGCCCAGACGTTGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BCAP31 (10134)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481258
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10134 | BCAP31 | B cell receptor associated ... | NM_001139441.1 | 100% | 100% | |
| 2 | human | 10134 | BCAP31 | B cell receptor associated ... | NM_001256447.2 | 100% | 100% | |
| 3 | human | 10134 | BCAP31 | B cell receptor associated ... | NM_005745.7 | 100% | 100% | |
| 4 | human | 10134 | BCAP31 | B cell receptor associated ... | NM_001139457.2 | 78.5% | 78.5% | 1_201del |
| 5 | human | 10134 | BCAP31 | B cell receptor associated ... | XR_002958761.1 | 34.1% | 1_156del;758_1584del;1722_2164del | |
| 6 | human | 10134 | BCAP31 | B cell receptor associated ... | XR_002958760.1 | 33% | 1_222del;824_1650del;1788_2230del | |
| 7 | human | 10134 | BCAP31 | B cell receptor associated ... | XR_002958759.1 | 29.9% | 1_457del;1059_1885del;2023_2465del | |
| 8 | human | 10134 | BCAP31 | B cell receptor associated ... | XR_002958758.1 | 27.9% | 1_631del;1233_2059del;2197_2639del | |
| 9 | mouse | 27061 | Bcap31 | B cell receptor associated ... | NM_001313698.1 | 88.3% | 90.6% | (many diffs) |
| 10 | mouse | 27061 | Bcap31 | B cell receptor associated ... | NM_012060.5 | 88.3% | 90.6% | (many diffs) |
| 11 | mouse | 27061 | Bcap31 | B cell receptor associated ... | XM_006528048.2 | 88.3% | 90.6% | (many diffs) |
| 12 | mouse | 27061 | Bcap31 | B cell receptor associated ... | XM_011247600.2 | 88.3% | 90.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 804
- ORF length:
- 738
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tctgcagtgg actgcagttg ccaccttcct ctatgcggag gtctttgttg 121 tgttgcttct ctgcattccc ttcatttctc ctaaaagatg gcagaagatt ttcaagtccc 181 ggctggtgga gttgttagtg tcctatggca acaccttctt tgtggttctc attgtcatcc 241 ttgtgctgtt ggtcatcgat gccgtgcgcg aaattcggaa gtatgatgat gtgacggaaa 301 aggtgaacct ccagaacaat cccggggcca tggagcactt ccacatgaag cttttccgtg 361 cccagaggaa tctctacatt gctggctttt ccttgctgct gtccttcctg cttagacgcc 421 TGGTGACTCT CATTTCGCAG CAGGCCACGC TGCTGGCCTC CAATGAAGCC TTTAAAAAGC 481 AGGCGGAGAG TGCTAGTGAG GCGGCCAAGA AGTACATGGA GGAGAATGAC CAGCTCAAGA 541 AGGGAGCTGC TGTTGACGGA GGCAAGTTGG ATGTCGGGAA TGCTGAGGTG AAGTTGGAGG 601 AAGAGAACAG GAGCCTGAAG GCTGACCTGC AGAAGCTAAA GGACGAGCTG GCCAGCACTA 661 AGCAAAAACT AGAGAAAGCT GAAAACCAGG TTCTGGCCAT GCGGAAGCAG TCTGAGGGCC 721 TCACCAAGGA GTACGACCGC TTGCTGGAGG AGCACGCAAA GCTGCAGGCT GCAGTAGATG 781 GTCCCATGGA CAAGAAGGAA GAGTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 841 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 901 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG AGCAGAGCGC 961 CCAGACGTTG TCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1021 att