Transcript: Mouse XM_006528581.3

PREDICTED: Mus musculus diaphanous related formin 2 (Diaph2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Diaph2 (54004)
Length:
8540
CDS:
312..3641

Additional Resources:

NCBI RefSeq record:
XM_006528581.3
NBCI Gene record:
Diaph2 (54004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293812 ATGATGTGCGTGACCGAATTA pLKO_005 478 CDS 100% 13.200 18.480 N DIAPH2 n/a
2 TRCN0000108784 GATGGAAGATATGAACCTTAA pLKO.1 659 CDS 100% 10.800 7.560 N Diaph2 n/a
3 TRCN0000303128 GATGGAAGATATGAACCTTAA pLKO_005 659 CDS 100% 10.800 7.560 N Diaph2 n/a
4 TRCN0000108781 GCCTGTTATTCAACATTCTAT pLKO.1 533 CDS 100% 5.625 3.938 N Diaph2 n/a
5 TRCN0000303004 GCCTGTTATTCAACATTCTAT pLKO_005 533 CDS 100% 5.625 3.938 N Diaph2 n/a
6 TRCN0000108783 GCTCATCAGAAATGATTACTA pLKO.1 1640 CDS 100% 5.625 3.938 N Diaph2 n/a
7 TRCN0000303002 GCTCATCAGAAATGATTACTA pLKO_005 1640 CDS 100% 5.625 3.938 N Diaph2 n/a
8 TRCN0000108782 GCCCTAATCCAGAATCTTGTA pLKO.1 2571 CDS 100% 4.950 3.465 N Diaph2 n/a
9 TRCN0000303077 GCCCTAATCCAGAATCTTGTA pLKO_005 2571 CDS 100% 4.950 3.465 N Diaph2 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 6607 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10778 pDONR223 100% 83.7% 82.7% None (many diffs) n/a
2 ccsbBroad304_10778 pLX_304 0% 83.7% 82.7% V5 (many diffs) n/a
Download CSV