Transcript: Mouse XM_006528608.2

PREDICTED: Mus musculus basic helix-loop-helix domain containing, class B9 (Bhlhb9), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bhlhb9 (70237)
Length:
3574
CDS:
1536..3155

Additional Resources:

NCBI RefSeq record:
XM_006528608.2
NBCI Gene record:
Bhlhb9 (70237)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215733 CAATACTCTTACAGCCATATT pLKO.1 3101 CDS 100% 13.200 10.560 N Bhlhb9 n/a
2 TRCN0000217932 GAGGAGGAAGAGAACGTTATT pLKO.1 2034 CDS 100% 13.200 9.240 N Bhlhb9 n/a
3 TRCN0000217062 CACAGATTGCAATGGGTATAC pLKO.1 2542 CDS 100% 10.800 7.560 N Bhlhb9 n/a
4 TRCN0000194138 GCTGGAGAAGATTCTGGTATT pLKO.1 1872 CDS 100% 10.800 7.560 N Bhlhb9 n/a
5 TRCN0000176118 GCGTGGTGACACTTATTGAAA pLKO.1 2605 CDS 100% 5.625 3.938 N Bhlhb9 n/a
6 TRCN0000176368 CCATAGGACTGAGAACAAGTT pLKO.1 1802 CDS 100% 4.950 3.465 N Bhlhb9 n/a
7 TRCN0000174307 CCAGAAATTAAAGAGAACACT pLKO.1 3162 3UTR 100% 3.000 2.100 N Bhlhb9 n/a
8 TRCN0000176315 CTAGCTCAAAGCTAGACCATT pLKO.1 3304 3UTR 100% 0.495 0.347 N Bhlhb9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.