Transcript: Mouse XM_006528694.1

PREDICTED: Mus musculus Rho GTPase activating protein 6 (Arhgap6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap6 (11856)
Length:
5341
CDS:
949..3912

Additional Resources:

NCBI RefSeq record:
XM_006528694.1
NBCI Gene record:
Arhgap6 (11856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105718 CCTTGTTAAAGGAGTTCCTTA pLKO.1 2354 CDS 100% 4.950 6.930 N Arhgap6 n/a
2 TRCN0000105715 CCTGCCATTTATGGTAAGATT pLKO.1 4076 3UTR 100% 5.625 4.500 N Arhgap6 n/a
3 TRCN0000378417 TGCTAATGACCGGGCATATAA pLKO_005 1815 CDS 100% 15.000 10.500 N Arhgap6 n/a
4 TRCN0000378400 ACAGTGGCACTCAGGTAATTC pLKO_005 3332 CDS 100% 13.200 9.240 N Arhgap6 n/a
5 TRCN0000362895 AGCTGAGTCTGAATCCTATTT pLKO_005 2153 CDS 100% 13.200 9.240 N Arhgap6 n/a
6 TRCN0000362896 GAAACTCTTGCTTCGTTATAG pLKO_005 4188 3UTR 100% 13.200 9.240 N Arhgap6 n/a
7 TRCN0000105716 CGGGCATATAAACTGAAGCAA pLKO.1 1825 CDS 100% 3.000 2.100 N Arhgap6 n/a
8 TRCN0000105717 GCCTTGTTAAAGGAGTTCCTT pLKO.1 2353 CDS 100% 3.000 2.100 N Arhgap6 n/a
9 TRCN0000105719 CCTGACATACTTCAGACGGAA pLKO.1 2866 CDS 100% 2.640 1.848 N Arhgap6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05848 pDONR223 100% 83.9% 84.7% None (many diffs) n/a
2 ccsbBroad304_05848 pLX_304 0% 83.9% 84.7% V5 (many diffs) n/a
3 TRCN0000476350 CACCAACCGCACCCAGCTGTATTC pLX_317 11.4% 83.9% 84.7% V5 (many diffs) n/a
Download CSV