Transcript: Mouse XM_006528789.3

PREDICTED: Mus musculus leucine-rich repeats and calponin homology (CH) domain containing 2 (Lrch2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrch2 (210297)
Length:
4770
CDS:
53..2401

Additional Resources:

NCBI RefSeq record:
XM_006528789.3
NBCI Gene record:
Lrch2 (210297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251466 ATAAGGCAGCTTCGCAATAAT pLKO_005 2048 CDS 100% 15.000 21.000 N Lrch2 n/a
2 TRCN0000265196 GCCAGAATCTCAGCCTATAAT pLKO_005 1774 CDS 100% 15.000 21.000 N Lrch2 n/a
3 TRCN0000251464 ACGTTTGGGTTCTTATCTAAA pLKO_005 3347 3UTR 100% 13.200 18.480 N Lrch2 n/a
4 TRCN0000265178 TGTGCTTGCCTCACCATATTT pLKO_005 2289 CDS 100% 15.000 10.500 N Lrch2 n/a
5 TRCN0000251465 CGTATCCATTCCCGAAGAAAT pLKO_005 649 CDS 100% 13.200 9.240 N Lrch2 n/a
6 TRCN0000137543 CCCAAGCAGATCTTTCCAGAA pLKO.1 417 CDS 100% 4.050 2.835 N LRCH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12378 pDONR223 100% 86.4% 89.2% None (many diffs) n/a
2 ccsbBroad304_12378 pLX_304 0% 86.4% 89.2% V5 (many diffs) n/a
3 TRCN0000474933 CAACAAAGGCGTAACACGGGGACC pLX_317 12.2% 86.4% 89.2% V5 (many diffs) n/a
Download CSV