Transcript: Mouse XM_006528790.3

PREDICTED: Mus musculus leucine-rich repeats and calponin homology (CH) domain containing 2 (Lrch2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrch2 (210297)
Length:
4691
CDS:
52..2322

Additional Resources:

NCBI RefSeq record:
XM_006528790.3
NBCI Gene record:
Lrch2 (210297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251466 ATAAGGCAGCTTCGCAATAAT pLKO_005 1969 CDS 100% 15.000 21.000 N Lrch2 n/a
2 TRCN0000265196 GCCAGAATCTCAGCCTATAAT pLKO_005 1695 CDS 100% 15.000 21.000 N Lrch2 n/a
3 TRCN0000251464 ACGTTTGGGTTCTTATCTAAA pLKO_005 3268 3UTR 100% 13.200 18.480 N Lrch2 n/a
4 TRCN0000265178 TGTGCTTGCCTCACCATATTT pLKO_005 2210 CDS 100% 15.000 10.500 N Lrch2 n/a
5 TRCN0000251465 CGTATCCATTCCCGAAGAAAT pLKO_005 648 CDS 100% 13.200 9.240 N Lrch2 n/a
6 TRCN0000137543 CCCAAGCAGATCTTTCCAGAA pLKO.1 416 CDS 100% 4.050 2.835 N LRCH2 n/a
7 TRCN0000134647 GAACAGAAGAACAGGATTCTT pLKO.1 1525 CDS 100% 0.563 0.394 N LRCH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12378 pDONR223 100% 89.4% 92.3% None (many diffs) n/a
2 ccsbBroad304_12378 pLX_304 0% 89.4% 92.3% V5 (many diffs) n/a
3 TRCN0000474933 CAACAAAGGCGTAACACGGGGACC pLX_317 12.2% 89.4% 92.3% V5 (many diffs) n/a
Download CSV