Transcript: Mouse XM_006528807.2

PREDICTED: Mus musculus adhesion G protein-coupled receptor G2 (Adgrg2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrg2 (237175)
Length:
5358
CDS:
508..3777

Additional Resources:

NCBI RefSeq record:
XM_006528807.2
NBCI Gene record:
Adgrg2 (237175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414292 GTTCAGCTCTGTCGAATTAAA pLKO_005 3151 CDS 100% 15.000 21.000 N Adgrg2 n/a
2 TRCN0000423479 TATCACGGTTGTGGGATATTT pLKO_005 3084 CDS 100% 15.000 21.000 N Adgrg2 n/a
3 TRCN0000221854 GCCATCTTTAACACCTTACAA pLKO.1 3316 CDS 100% 5.625 7.875 N Adgrg2 n/a
4 TRCN0000413479 TTCAGTCTGTTGGTAAGTTTA pLKO_005 4176 3UTR 100% 13.200 10.560 N Adgrg2 n/a
5 TRCN0000436715 CTGATGGCTGTTCCGTCAAAG pLKO_005 2480 CDS 100% 10.800 8.640 N Adgrg2 n/a
6 TRCN0000221853 GCTGTATAATACCCGAGGTTT pLKO.1 2781 CDS 100% 4.950 3.960 N Adgrg2 n/a
7 TRCN0000367776 GGTTCAGCTCTGTCGAATTAA pLKO_005 3150 CDS 100% 15.000 10.500 N ADGRG2 n/a
8 TRCN0000221852 CCTCCTTTAGAAGATCATATA pLKO.1 4365 3UTR 100% 13.200 9.240 N Adgrg2 n/a
9 TRCN0000221855 GCTCTGACATTTATCACGTAT pLKO.1 2602 CDS 100% 4.950 3.465 N Adgrg2 n/a
10 TRCN0000221856 GCTTACACTTTATCGAGCAAA pLKO.1 3752 CDS 100% 4.950 3.465 N Adgrg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.