Transcript: Mouse XM_006528922.1

PREDICTED: Mus musculus RAB9, member RAS oncogene family (Rab9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab9 (56382)
Length:
1145
CDS:
83..688

Additional Resources:

NCBI RefSeq record:
XM_006528922.1
NBCI Gene record:
Rab9 (56382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305882 TCTGGAGGTGGACGGACATTT pLKO_005 226 CDS 100% 13.200 18.480 N Rab9 n/a
2 TRCN0000100908 GCGACTATCCTTACTTTGAAA pLKO.1 519 CDS 100% 5.625 7.875 N Rab9 n/a
3 TRCN0000324987 GCGACTATCCTTACTTTGAAA pLKO_005 519 CDS 100% 5.625 7.875 N Rab9 n/a
4 TRCN0000100906 GAGTTCTCTTATGAACAGATA pLKO.1 142 CDS 100% 4.950 3.960 N Rab9 n/a
5 TRCN0000305945 CTTGCTGTTGATGGCATTAAA pLKO_005 678 CDS 100% 15.000 10.500 N Rab9 n/a
6 TRCN0000382339 GACTGTTGCCTGCTTACATTT pLKO_005 323 CDS 100% 13.200 9.240 N Rab9 n/a
7 TRCN0000305946 TGGGCAACAAGACTGACATAA pLKO_005 447 CDS 100% 13.200 9.240 N Rab9 n/a
8 TRCN0000100909 CCAGAATTTGAGCAACTGGAA pLKO.1 367 CDS 100% 2.640 1.848 N Rab9 n/a
9 TRCN0000100907 CTGCTTACATTTAGTGTCGAT pLKO.1 332 CDS 100% 2.640 1.848 N Rab9 n/a
10 TRCN0000381000 ATAGGTCAGAACACCTGATTC pLKO_005 612 CDS 100% 10.800 6.480 N Rab9 n/a
11 TRCN0000100905 GCAGAAGAGTTCATTTACTAA pLKO.1 767 3UTR 100% 5.625 3.375 N Rab9 n/a
12 TRCN0000324986 GCAGAAGAGTTCATTTACTAA pLKO_005 767 3UTR 100% 5.625 3.375 N Rab9 n/a
13 TRCN0000307297 GACAACGGCGACTATCCTTAT pLKO_005 512 CDS 100% 10.800 15.120 N RAB9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02150 pDONR223 100% 90.3% 95.5% None (many diffs) n/a
2 ccsbBroad304_02150 pLX_304 0% 90.3% 95.5% V5 (many diffs) n/a
3 TRCN0000467524 GTTTTCCGTGTACAAGGTCCCCTG pLX_317 69.5% 90.3% 95.5% V5 (many diffs) n/a
Download CSV