Transcript: Mouse XM_006528998.3

PREDICTED: Mus musculus melanoma antigen, family D, 2 (Maged2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Maged2 (80884)
Length:
2100
CDS:
108..1958

Additional Resources:

NCBI RefSeq record:
XM_006528998.3
NBCI Gene record:
Maged2 (80884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350693 ATACTCGGCCCAAGGTCAAAG pLKO_005 607 CDS 100% 10.800 15.120 N MAGED2 n/a
2 TRCN0000095029 TGCTAATAATCACAGCGTCTT pLKO.1 1968 3UTR 100% 4.050 5.670 N Maged2 n/a
3 TRCN0000095031 GCCAACTGATGCAGGCATATT pLKO.1 1166 CDS 100% 13.200 10.560 N Maged2 n/a
4 TRCN0000095033 AGCCAACTGATGCAGGCATAT pLKO.1 1165 CDS 100% 10.800 7.560 N Maged2 n/a
5 TRCN0000322634 AGGGTCTCAAAGGCCCTAATG pLKO_005 717 CDS 100% 10.800 7.560 N MAGED2 n/a
6 TRCN0000322563 CATTGAACGAGCAGGCTATTC pLKO_005 1067 CDS 100% 10.800 7.560 N MAGED2 n/a
7 TRCN0000095032 GCCAGAGTACCCAATAGCAAT pLKO.1 1392 CDS 100% 4.950 3.465 N Maged2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02558 pDONR223 100% 87.2% 86.2% None (many diffs) n/a
2 ccsbBroad304_02558 pLX_304 0% 87.2% 86.2% V5 (many diffs) n/a
3 TRCN0000467238 GGAACCGAGTTCATGCCAATAGCC pLX_317 18% 87.2% 86.2% V5 (many diffs) n/a
Download CSV