Transcript: Mouse XM_006529055.3

PREDICTED: Mus musculus mannoside acetylglucosaminyltransferase 5 (Mgat5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mgat5 (107895)
Length:
8476
CDS:
645..2867

Additional Resources:

NCBI RefSeq record:
XM_006529055.3
NBCI Gene record:
Mgat5 (107895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018753 GCAGATATCATTAATGGAGTT pLKO.1 1044 CDS 100% 4.050 5.670 N Mgat5 n/a
2 TRCN0000018755 CCAGAAGATTGAGCCGTATAT pLKO.1 2429 CDS 100% 13.200 9.240 N Mgat5 n/a
3 TRCN0000018754 CCTCTGCAAAGACTGCCTATA pLKO.1 2846 CDS 100% 10.800 7.560 N Mgat5 n/a
4 TRCN0000018752 GCAGAGAATCAACGCTTTCAT pLKO.1 2480 CDS 100% 5.625 3.938 N Mgat5 n/a
5 TRCN0000018756 CCCTATGAAGAAGCTGATCAT pLKO.1 1257 CDS 100% 4.950 3.465 N Mgat5 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7909 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.