Transcript: Mouse XM_006529283.3

PREDICTED: Mus musculus nuclear antigen Sp100 (Sp100), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sp100 (20684)
Length:
2991
CDS:
159..2111

Additional Resources:

NCBI RefSeq record:
XM_006529283.3
NBCI Gene record:
Sp100 (20684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226299 CTGAGAGCTCTATCATCATTA pLKO_005 1048 CDS 100% 13.200 18.480 N Sp100 n/a
2 TRCN0000092796 GTGCCAGCTATTCTCAAGGAA pLKO.1 592 CDS 100% 3.000 2.400 N Sp100 n/a
3 TRCN0000218675 ATGAGGACTCTGAGATAATAG pLKO_005 892 CDS 100% 13.200 9.240 N Sp100 n/a
4 TRCN0000226301 CCGGGAGCACATGTGGTTAAA pLKO_005 1865 CDS 100% 13.200 9.240 N Sp100 n/a
5 TRCN0000226300 GAGACTTGGAAGCTACTTAAT pLKO_005 1103 CDS 100% 13.200 9.240 N Sp100 n/a
6 TRCN0000226302 TCCCGTCTCTAACCTTCTATA pLKO_005 2203 3UTR 100% 13.200 9.240 N Sp100 n/a
7 TRCN0000092795 GCTGGAGAAGTAATGATAGAA pLKO.1 652 CDS 100% 5.625 3.938 N Sp100 n/a
8 TRCN0000092797 CCTGAGAGAACTGATACAGAA pLKO.1 1445 CDS 100% 4.950 3.465 N Sp100 n/a
9 TRCN0000092793 CCCAATGAATTGTGTTTCCAA pLKO.1 519 CDS 100% 3.000 1.800 N Sp100 n/a
10 TRCN0000092794 CCATTTCTAATGCGATAAGAA pLKO.1 262 CDS 100% 5.625 2.813 Y Sp100 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.