Transcript: Mouse XM_006529368.3

PREDICTED: Mus musculus bone morphogenetic protein/retinoic acid inducible neural specific 3 (Brinp3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brinp3 (215378)
Length:
3314
CDS:
753..3053

Additional Resources:

NCBI RefSeq record:
XM_006529368.3
NBCI Gene record:
Brinp3 (215378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119346 CCAACAGCAATGAGAGCATTT pLKO.1 2665 CDS 100% 10.800 8.640 N Brinp3 n/a
2 TRCN0000119344 GCACCAATAGTTCGTCTGTTA pLKO.1 1249 CDS 100% 4.950 3.960 N Brinp3 n/a
3 TRCN0000152416 CACACATGAACTTGCTGACAA pLKO.1 3193 3UTR 100% 4.950 3.465 N BRINP3 n/a
4 TRCN0000119345 CCTAGAGATGAAATACCTGTT pLKO.1 2234 CDS 100% 4.050 2.835 N Brinp3 n/a
5 TRCN0000119343 CGAGTTTATCTGCAAGGATAA pLKO.1 1559 CDS 100% 1.080 0.756 N Brinp3 n/a
6 TRCN0000119342 GTGGAAGTTTATGTTTGGAAA pLKO.1 3107 3UTR 100% 4.950 2.970 N Brinp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05461 pDONR223 100% 91.1% 97.7% None (many diffs) n/a
2 TRCN0000477767 TTCCTAGCGATTTCTCAATACATG pLX_317 17% 91.1% 97.7% V5 (many diffs) n/a
Download CSV