Transcript: Mouse XM_006529420.2

PREDICTED: Mus musculus R3H domain containing 1 (R3hdm1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
R3hdm1 (226412)
Length:
4692
CDS:
439..3714

Additional Resources:

NCBI RefSeq record:
XM_006529420.2
NBCI Gene record:
R3hdm1 (226412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080919 CGCCAGATATTTAGAGTTAAT pLKO.1 1285 CDS 100% 13.200 10.560 N R3hdm1 n/a
2 TRCN0000324818 CGCCAGATATTTAGAGTTAAT pLKO_005 1285 CDS 100% 13.200 10.560 N R3hdm1 n/a
3 TRCN0000080921 GCAGTTGGTTACTTACAACAT pLKO.1 2767 CDS 100% 4.950 3.960 N R3hdm1 n/a
4 TRCN0000324903 GCAGTTGGTTACTTACAACAT pLKO_005 2767 CDS 100% 4.950 3.960 N R3hdm1 n/a
5 TRCN0000080918 CCCATCTGATTGGCTTGTTAA pLKO.1 3762 3UTR 100% 13.200 9.240 N R3hdm1 n/a
6 TRCN0000324816 CCCATCTGATTGGCTTGTTAA pLKO_005 3762 3UTR 100% 13.200 9.240 N R3hdm1 n/a
7 TRCN0000082692 CAGATGAGAATACGTTTGAAA pLKO.1 1111 CDS 100% 5.625 3.938 N R3HDM1 n/a
8 TRCN0000291108 CAGATGAGAATACGTTTGAAA pLKO_005 1111 CDS 100% 5.625 3.938 N R3HDM1 n/a
9 TRCN0000080920 CCAGTCTATTACAGTGTCATT pLKO.1 2716 CDS 100% 4.950 3.465 N R3hdm1 n/a
10 TRCN0000324901 CCAGTCTATTACAGTGTCATT pLKO_005 2716 CDS 100% 4.950 3.465 N R3hdm1 n/a
11 TRCN0000080922 GCCAGCAATCACAGTTCTCTT pLKO.1 1645 CDS 100% 4.950 3.465 N R3hdm1 n/a
12 TRCN0000324815 GCCAGCAATCACAGTTCTCTT pLKO_005 1645 CDS 100% 4.950 3.465 N R3hdm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.