Transcript: Mouse XM_006529446.3

PREDICTED: Mus musculus zinc finger and BTB domain containing 41 (Zbtb41), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb41 (226470)
Length:
8924
CDS:
723..3449

Additional Resources:

NCBI RefSeq record:
XM_006529446.3
NBCI Gene record:
Zbtb41 (226470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241767 ATCCCGGTTTGCACGGTTAAA pLKO_005 2222 CDS 100% 13.200 18.480 N Zbtb41 n/a
2 TRCN0000241770 ATTCGACAAAGTCTAACTTAA pLKO_005 1912 CDS 100% 13.200 18.480 N Zbtb41 n/a
3 TRCN0000215320 CAACATTGCAATGCAACATTT pLKO.1 2898 CDS 100% 13.200 18.480 N Zbtb41 n/a
4 TRCN0000241771 CAACCGTCTTTCTGCGATTTA pLKO_005 975 CDS 100% 13.200 18.480 N Zbtb41 n/a
5 TRCN0000241769 TGCTGTCGGCAGTAGTTATTT pLKO_005 1043 CDS 100% 15.000 12.000 N Zbtb41 n/a
6 TRCN0000244940 TGCTGTCGGCAGTAGTTATTT pLKO_005 1043 CDS 100% 15.000 12.000 N ZBTB41 n/a
7 TRCN0000241768 TAGATCAAATCGAGGTTATTT pLKO_005 6773 3UTR 100% 15.000 10.500 N Zbtb41 n/a
8 TRCN0000179991 CATCACGATGACAAGAGATAT pLKO.1 2508 CDS 100% 13.200 9.240 N Zbtb41 n/a
9 TRCN0000216816 GATCCATCTAGGCTATCATAA pLKO.1 764 CDS 100% 13.200 9.240 N Zbtb41 n/a
10 TRCN0000183061 CCTCAATTTGTGATAGACTTT pLKO.1 3799 3UTR 100% 4.950 3.465 N Zbtb41 n/a
11 TRCN0000179637 GCATCAAGAAAGTTCTGAGAA pLKO.1 1565 CDS 100% 4.950 3.465 N Zbtb41 n/a
12 TRCN0000149075 GAGAAGATCCATCTAGGCTAT pLKO.1 759 CDS 100% 4.050 2.835 N ZBTB41 n/a
13 TRCN0000420991 AGTGTGAAGAGTGTGGAAATT pLKO_005 2614 CDS 100% 13.200 6.600 Y Zfp874a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.