Transcript: Mouse XM_006529455.3

PREDICTED: Mus musculus nicotinamide nucleotide adenylyltransferase 2 (Nmnat2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nmnat2 (226518)
Length:
4662
CDS:
215..1066

Additional Resources:

NCBI RefSeq record:
XM_006529455.3
NBCI Gene record:
Nmnat2 (226518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111475 CCCTTCTGATAGGACACTATA pLKO.1 1528 3UTR 100% 13.200 18.480 N Nmnat2 n/a
2 TRCN0000111478 CCAGCCAGTCATCGATTACAT pLKO.1 1009 CDS 100% 5.625 7.875 N Nmnat2 n/a
3 TRCN0000035443 GCCCATTTACCAGAACAGCAA pLKO.1 547 CDS 100% 2.640 3.696 N NMNAT2 n/a
4 TRCN0000111476 CCCATCACTAAAGGGCACATT pLKO.1 137 5UTR 100% 4.950 3.960 N Nmnat2 n/a
5 TRCN0000111479 GCAGATATGGAAGTGATTGTT pLKO.1 788 CDS 100% 5.625 3.938 N Nmnat2 n/a
6 TRCN0000111477 CCCATTTACCAGAACAGCAAT pLKO.1 548 CDS 100% 4.950 3.465 N Nmnat2 n/a
7 TRCN0000035440 GCCAGGGATTATCTGCACAAA pLKO.1 233 CDS 100% 4.950 3.465 N NMNAT2 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1622 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02716 pDONR223 100% 85.7% 90.7% None (many diffs) n/a
2 ccsbBroad304_02716 pLX_304 0% 85.7% 90.7% V5 (many diffs) n/a
3 TRCN0000471818 TCAATGTATACTGCAGATACCCGA pLX_317 49% 85.7% 90.7% V5 (many diffs) n/a
Download CSV