Transcript: Mouse XM_006529490.3

PREDICTED: Mus musculus diphosphoinositol pentakisphosphate kinase 2 (Ppip5k2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppip5k2 (227399)
Length:
5660
CDS:
351..4097

Additional Resources:

NCBI RefSeq record:
XM_006529490.3
NBCI Gene record:
Ppip5k2 (227399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241780 CACGTCCGCACCAGATTATAT pLKO_005 2814 CDS 100% 15.000 21.000 N Ppip5k2 n/a
2 TRCN0000193063 CCGAAAGTTTCCATGCTTATA pLKO.1 4111 3UTR 100% 13.200 18.480 N Ppip5k2 n/a
3 TRCN0000241778 TAAACCGTAAGGTCCAATTAA pLKO_005 1792 CDS 100% 15.000 12.000 N Ppip5k2 n/a
4 TRCN0000192355 CCATTCTTATGTCCAGTGTAT pLKO.1 5012 3UTR 100% 4.950 3.960 N Ppip5k2 n/a
5 TRCN0000241777 TCTCGGAAGAAGAGCATAAAT pLKO_005 4026 CDS 100% 15.000 10.500 N Ppip5k2 n/a
6 TRCN0000365127 CACCTAACCTACAGGATTATG pLKO_005 3589 CDS 100% 13.200 9.240 N PPIP5K2 n/a
7 TRCN0000217308 GGAAACGAGCTATGGATTATC pLKO.1 2917 CDS 100% 13.200 9.240 N Ppip5k2 n/a
8 TRCN0000241781 GTCATTGCTACAGTAACATAT pLKO_005 4594 3UTR 100% 13.200 9.240 N Ppip5k2 n/a
9 TRCN0000241779 TCTTCGGTATGGCGCCTTATG pLKO_005 2873 CDS 100% 10.800 7.560 N Ppip5k2 n/a
10 TRCN0000191288 CCAATTCATATACACAGGAAA pLKO.1 3228 CDS 100% 4.950 3.465 N Ppip5k2 n/a
11 TRCN0000136441 CCCAAATCATTGGCTTTCACA pLKO.1 3414 CDS 100% 3.000 2.100 N PPIP5K2 n/a
12 TRCN0000376570 GAAACGAGCTATGGATTATTT pLKO_005 2918 CDS 100% 15.000 10.500 N PPIP5K2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02743 pDONR223 100% 87.5% 93.2% None (many diffs) n/a
2 ccsbBroad304_02743 pLX_304 0% 87.5% 93.2% V5 (many diffs) n/a
Download CSV