Transcript: Mouse XM_006529496.2

PREDICTED: Mus musculus diphosphoinositol pentakisphosphate kinase 2 (Ppip5k2), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppip5k2 (227399)
Length:
5481
CDS:
355..3918

Additional Resources:

NCBI RefSeq record:
XM_006529496.2
NBCI Gene record:
Ppip5k2 (227399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241780 CACGTCCGCACCAGATTATAT pLKO_005 2818 CDS 100% 15.000 21.000 N Ppip5k2 n/a
2 TRCN0000193063 CCGAAAGTTTCCATGCTTATA pLKO.1 3932 3UTR 100% 13.200 18.480 N Ppip5k2 n/a
3 TRCN0000241778 TAAACCGTAAGGTCCAATTAA pLKO_005 1796 CDS 100% 15.000 12.000 N Ppip5k2 n/a
4 TRCN0000192355 CCATTCTTATGTCCAGTGTAT pLKO.1 4833 3UTR 100% 4.950 3.960 N Ppip5k2 n/a
5 TRCN0000241777 TCTCGGAAGAAGAGCATAAAT pLKO_005 3847 CDS 100% 15.000 10.500 N Ppip5k2 n/a
6 TRCN0000217308 GGAAACGAGCTATGGATTATC pLKO.1 2921 CDS 100% 13.200 9.240 N Ppip5k2 n/a
7 TRCN0000241781 GTCATTGCTACAGTAACATAT pLKO_005 4415 3UTR 100% 13.200 9.240 N Ppip5k2 n/a
8 TRCN0000241779 TCTTCGGTATGGCGCCTTATG pLKO_005 2877 CDS 100% 10.800 7.560 N Ppip5k2 n/a
9 TRCN0000191288 CCAATTCATATACACAGGAAA pLKO.1 3232 CDS 100% 4.950 3.465 N Ppip5k2 n/a
10 TRCN0000136441 CCCAAATCATTGGCTTTCACA pLKO.1 3418 CDS 100% 3.000 2.100 N PPIP5K2 n/a
11 TRCN0000376570 GAAACGAGCTATGGATTATTT pLKO_005 2922 CDS 100% 15.000 10.500 N PPIP5K2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02743 pDONR223 100% 85.9% 91.6% None (many diffs) n/a
2 ccsbBroad304_02743 pLX_304 0% 85.9% 91.6% V5 (many diffs) n/a
Download CSV