Transcript: Mouse XM_006529782.1

PREDICTED: Mus musculus v-ral simian leukemia viral oncogene B (Ralb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ralb (64143)
Length:
2104
CDS:
86..706

Additional Resources:

NCBI RefSeq record:
XM_006529782.1
NBCI Gene record:
Ralb (64143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077746 CAAGGTATTCTTTGATCTGAT pLKO.1 583 CDS 100% 4.950 3.465 N Ralb n/a
2 TRCN0000354090 CAAGGTATTCTTTGATCTGAT pLKO_005 583 CDS 100% 4.950 3.465 N Ralb n/a
3 TRCN0000077743 CGGTCATCTTTCCTTAGGAAA pLKO.1 1040 3UTR 100% 4.950 3.465 N Ralb n/a
4 TRCN0000326203 CGGTCATCTTTCCTTAGGAAA pLKO_005 1040 3UTR 100% 4.950 3.465 N Ralb n/a
5 TRCN0000077744 GAAGACTATGAGCCCACCAAA pLKO.1 206 CDS 100% 4.950 3.465 N Ralb n/a
6 TRCN0000077745 CCTGGTACTTCACAAGGTCAT pLKO.1 118 CDS 100% 4.050 2.835 N Ralb n/a
7 TRCN0000326129 CCTGGTACTTCACAAGGTCAT pLKO_005 118 CDS 100% 4.050 2.835 N Ralb n/a
8 TRCN0000077747 GATGAGAGAAATCCGGGCAAA pLKO.1 601 CDS 100% 4.050 2.835 N Ralb n/a
9 TRCN0000326130 GATGAGAGAAATCCGGGCAAA pLKO_005 601 CDS 100% 4.050 2.835 N Ralb n/a
10 TRCN0000072957 GAGTTTGTAGAAGACTATGAA pLKO.1 197 CDS 100% 5.625 3.375 N RALB n/a
11 TRCN0000299773 GAGTTTGTAGAAGACTATGAA pLKO_005 197 CDS 100% 5.625 3.375 N RALB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01372 pDONR223 100% 85.2% 95.1% None (many diffs) n/a
2 ccsbBroad304_01372 pLX_304 0% 85.2% 95.1% V5 (many diffs) n/a
3 TRCN0000473581 TTGATCGTTGCTACCCGTAAGCGA pLX_317 84.6% 85.2% 95.1% V5 (many diffs) n/a
Download CSV