Transcript: Mouse XM_006529802.3

PREDICTED: Mus musculus RIKEN cDNA 5730559C18 gene (5730559C18Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
5730559C18Rik (67313)
Length:
3021
CDS:
189..2219

Additional Resources:

NCBI RefSeq record:
XM_006529802.3
NBCI Gene record:
5730559C18Rik (67313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341315 TGTGCGCACACCCTCACTAAA pLKO_005 1922 CDS 100% 13.200 9.240 N 5730559C18Rik n/a
2 TRCN0000192045 CGACAGCATTTGTCTCCTTAT pLKO.1 2490 3UTR 100% 10.800 7.560 N 5730559C18Rik n/a
3 TRCN0000352487 CGACAGCATTTGTCTCCTTAT pLKO_005 2490 3UTR 100% 10.800 7.560 N 5730559C18Rik n/a
4 TRCN0000201002 CCAATGAAAGAGCTGACCAAT pLKO.1 561 CDS 100% 4.950 3.465 N 5730559C18Rik n/a
5 TRCN0000341314 CCAATGAAAGAGCTGACCAAT pLKO_005 561 CDS 100% 4.950 3.465 N 5730559C18Rik n/a
6 TRCN0000191588 GAAACTCATCATGGAGAGTAA pLKO.1 476 CDS 100% 4.950 3.465 N 5730559C18Rik n/a
7 TRCN0000202365 GCAAGTCTTTGTGCCTGAGAA pLKO.1 2174 CDS 100% 4.950 3.465 N 5730559C18Rik n/a
8 TRCN0000352562 GCAAGTCTTTGTGCCTGAGAA pLKO_005 2174 CDS 100% 4.950 3.465 N 5730559C18Rik n/a
9 TRCN0000192072 CCTCTTTCTGAGATACCTGTT pLKO.1 2562 3UTR 100% 4.050 2.835 N 5730559C18Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08584 pDONR223 100% 82.2% 83.6% None (many diffs) n/a
2 TRCN0000470845 CTACACCCTTAAGGCGGGTTAGCA pLX_317 17% 82.2% 83.6% V5 (many diffs) n/a
Download CSV