Transcript: Mouse XM_006530012.1

PREDICTED: Mus musculus RIKEN cDNA B020011L13 gene (B020011L13Rik), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
B020011L13Rik (547097)
Length:
2709
CDS:
283..1761

Additional Resources:

NCBI RefSeq record:
XM_006530012.1
NBCI Gene record:
B020011L13Rik (547097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239669 TTTCATGCACCAGACTAAATT pLKO_005 2167 3UTR 100% 15.000 12.000 N B020011L13Rik n/a
2 TRCN0000239672 GAATCCATTCTAGAGATATAT pLKO_005 1664 CDS 100% 15.000 10.500 N B020011L13Rik n/a
3 TRCN0000217990 GATTGCATACTGGATACAAAC pLKO_005 1328 CDS 100% 10.800 7.560 N Zfp813-ps n/a
4 TRCN0000239671 TCACGTGACATCTTACAAATG pLKO_005 498 CDS 100% 10.800 7.560 N B020011L13Rik n/a
5 TRCN0000225615 ACACAGTATTCAGATCTTAAA pLKO_005 877 CDS 100% 13.200 7.920 N Zfp813-ps n/a
6 TRCN0000239673 ACCCAGTCTTCCCAACTTAAT pLKO_005 1549 CDS 100% 13.200 7.920 N B020011L13Rik n/a
7 TRCN0000239670 TCCTCATCTCTTCAAGTTTAC pLKO_005 1639 CDS 100% 10.800 6.480 N B020011L13Rik n/a
8 TRCN0000191011 CAGGAGACAAACCTTACAAAT pLKO.1 749 CDS 100% 13.200 6.600 Y Zfp945 n/a
9 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 759 CDS 100% 10.800 5.400 Y Rex2 n/a
10 TRCN0000242167 CTCTAAGGAGGAGTGGGAATG pLKO_005 333 CDS 100% 6.000 3.000 Y Zfp616 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.