Transcript: Mouse XM_006530055.3

PREDICTED: Mus musculus zinc finger protein 704 (Zfp704), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp704 (170753)
Length:
13058
CDS:
52..1281

Additional Resources:

NCBI RefSeq record:
XM_006530055.3
NBCI Gene record:
Zfp704 (170753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421631 GCCCATAAGCTACACAATATA pLKO_005 1632 3UTR 100% 15.000 21.000 N Zfp704 n/a
2 TRCN0000111975 CGCTAAACTTTGTTGTCTTAT pLKO.1 2337 3UTR 100% 13.200 18.480 N Zfp704 n/a
3 TRCN0000435976 GTCGGGTCCTTGACCAAGAAA pLKO_005 170 CDS 100% 5.625 7.875 N Zfp704 n/a
4 TRCN0000111978 CACGTTTCAATCAGAGGACTT pLKO.1 60 CDS 100% 4.050 5.670 N Zfp704 n/a
5 TRCN0000439426 CACAGTCTGAGGTAGCATTTG pLKO_005 1664 3UTR 100% 10.800 7.560 N Zfp704 n/a
6 TRCN0000433126 AGAAGCGGAAAGTAGTTTCTT pLKO_005 221 CDS 100% 5.625 3.938 N Zfp704 n/a
7 TRCN0000419349 CGATGTCCCTCCTGCAAGAAA pLKO_005 249 CDS 100% 5.625 3.938 N Zfp704 n/a
8 TRCN0000438798 CAGTAAGAAGCCGTCTCATCA pLKO_005 93 CDS 100% 4.950 3.465 N Zfp704 n/a
9 TRCN0000111979 CTTCTACTACACGGAGATCAA pLKO.1 738 CDS 100% 4.950 3.465 N Zfp704 n/a
10 TRCN0000436492 GACTGCAGCCATGGTATTGAC pLKO_005 300 CDS 100% 4.950 3.465 N Zfp704 n/a
11 TRCN0000111976 GCAAGGTTTATGGGATGGAAA pLKO.1 1199 CDS 100% 4.950 3.465 N Zfp704 n/a
12 TRCN0000443140 AGCCGAACAGAAACTCCTTGT pLKO_005 859 CDS 100% 4.050 2.835 N Zfp704 n/a
13 TRCN0000424566 ATGAGCCCATTCCGAGGAAGA pLKO_005 572 CDS 100% 4.050 2.835 N Zfp704 n/a
14 TRCN0000163139 GAACAGAAACTCCTTGTGCCA pLKO.1 863 CDS 100% 0.660 0.462 N ZNF704 n/a
15 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 9476 3UTR 100% 4.950 2.475 Y Gad2 n/a
16 TRCN0000162877 GCTTCAGCATTTCCTGGCAAT pLKO.1 1022 CDS 100% 4.050 2.835 N ZNF704 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05707 pDONR223 100% 84.6% 89.1% None (many diffs) n/a
2 ccsbBroad304_05707 pLX_304 0% 84.6% 89.1% V5 (many diffs) n/a
Download CSV