Transcript: Mouse XM_006530234.3

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase kinase 2, beta (Camkk2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camkk2 (207565)
Length:
1917
CDS:
276..1889

Additional Resources:

NCBI RefSeq record:
XM_006530234.3
NBCI Gene record:
Camkk2 (207565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530234.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276714 TTTCCCGACCAGCCCGATATA pLKO_005 1500 CDS 100% 13.200 18.480 N Camkk2 n/a
2 TRCN0000028815 CGGTGTAAGCAACGAGTTCAA pLKO.1 1268 CDS 100% 4.950 6.930 N Camkk2 n/a
3 TRCN0000276713 CGGTGTAAGCAACGAGTTCAA pLKO_005 1268 CDS 100% 4.950 6.930 N Camkk2 n/a
4 TRCN0000028776 CCATGATTCGAAAGCGCTCAT pLKO.1 1741 CDS 100% 4.050 3.240 N Camkk2 n/a
5 TRCN0000276712 CCATGATTCGAAAGCGCTCAT pLKO_005 1741 CDS 100% 4.050 3.240 N Camkk2 n/a
6 TRCN0000028761 CCCTTTCATGGATGAACGAAT pLKO.1 1439 CDS 100% 4.950 3.465 N Camkk2 n/a
7 TRCN0000028764 GTATCCACTTGGGCATGGAAT pLKO.1 403 CDS 100% 4.950 3.465 N Camkk2 n/a
8 TRCN0000276649 GTATCCACTTGGGCATGGAAT pLKO_005 403 CDS 100% 4.950 3.465 N Camkk2 n/a
9 TRCN0000028809 GCTGAATCAGTACACCCTGAA pLKO.1 758 CDS 100% 4.050 2.835 N Camkk2 n/a
10 TRCN0000002300 AGTCAAACACATTCCCAGCTT pLKO.1 1697 CDS 100% 2.640 1.848 N CAMKK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530234.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489004 CTGAGTCACCCCACTTCCGCACTA pLX_317 17.4% 84.6% 89% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489407 TCATTGGCTCTTTCTTGGTCAGCC pLX_317 18.3% 84.5% 89% V5 (many diffs) n/a
3 TRCN0000491777 CTGATCGGTCACTTAGGGTCTCAT pLX_317 27.7% 77.5% 81.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV