Construct: ORF TRCN0000489407
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019073.1_s317c1
- DNA Barcode:
- TCATTGGCTCTTTCTTGGTCAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CAMKK2 (10645)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489407
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_153499.2 | 99.8% | 99.8% | 630C>T;963A>T;1623_1624insG |
| 2 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_172226.2 | 99.8% | 99.8% | 630C>T;963A>T;1623_1624insG |
| 3 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018700.1 | 96.6% | 96.6% | (many diffs) |
| 4 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_172214.3 | 95.4% | 95.9% | (many diffs) |
| 5 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_005253823.1 | 95.4% | 95.9% | (many diffs) |
| 6 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_001270486.1 | 94.6% | 93.2% | (many diffs) |
| 7 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_011537763.1 | 94.6% | 93.2% | (many diffs) |
| 8 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018702.2 | 94.6% | 93.2% | (many diffs) |
| 9 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018703.1 | 92.4% | 92.8% | (many diffs) |
| 10 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_001270485.2 | 91.8% | 87.1% | (many diffs) |
| 11 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_006549.3 | 91.8% | 87.1% | (many diffs) |
| 12 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_153500.1 | 91.8% | 91.8% | (many diffs) |
| 13 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_005253824.3 | 91.8% | 91.8% | (many diffs) |
| 14 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018694.1 | 89.1% | 84.6% | (many diffs) |
| 15 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018695.1 | 89.1% | 84.6% | (many diffs) |
| 16 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018705.1 | 88.9% | 88.9% | (many diffs) |
| 17 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_172215.3 | 87.6% | 88% | (many diffs) |
| 18 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | NM_172216.1 | 84.5% | 80% | (many diffs) |
| 19 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_005253822.3 | 84.5% | 80% | (many diffs) |
| 20 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018699.1 | 82% | 77.6% | (many diffs) |
| 21 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_024448798.1 | 69% | 67.8% | (many diffs) |
| 22 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018708.1 | 65% | 64.2% | (many diffs) |
| 23 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018706.1 | 64.9% | 62.4% | (many diffs) |
| 24 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_011537764.2 | 63.5% | 58.3% | (many diffs) |
| 25 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_017018709.2 | 45.1% | 41.3% | (many diffs) |
| 26 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XM_024448799.1 | 45.1% | 41.3% | (many diffs) |
| 27 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XR_001748557.1 | 32.2% | (many diffs) | |
| 28 | human | 10645 | CAMKK2 | calcium/calmodulin dependen... | XR_001748558.1 | 31.9% | (many diffs) | |
| 29 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | NM_145358.2 | 87.2% | 92.2% | (many diffs) |
| 30 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_006530234.3 | 84.5% | 89% | (many diffs) |
| 31 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | NM_001199676.1 | 80.3% | 81.3% | (many diffs) |
| 32 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_017320763.1 | 80.3% | 81.3% | (many diffs) |
| 33 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_006530235.3 | 80% | 84.3% | (many diffs) |
| 34 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_006530230.3 | 74.4% | 76.6% | (many diffs) |
| 35 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_006530231.3 | 74.4% | 76.6% | (many diffs) |
| 36 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_006530233.3 | 73.7% | 74.2% | (many diffs) |
| 37 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_006530232.3 | 68.2% | 69.9% | (many diffs) |
| 38 | mouse | 207565 | Camkk2 | calcium/calmodulin-dependen... | XM_006530236.3 | 48.5% | 51.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1698
- ORF length:
- 1626
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcatca tgtgtctcta gccagcccag cagcaaccgg gccgcccccc 121 aggatgagct ggggggcagg ggcagcagca gcagcgaaag ccagaagccc tgtgaggccc 181 tgcggggcct ctcatccttg agcatccacc tgggcatgga gtccttcatt gtggtcaccg 241 agtgtgagcc gggctgtgct gtggacctcg gcttggcgcg ggaccggccc ctggaggccg 301 atggccaaga ggtccccctt gacacctccg ggtcccaggc ccggccccac ctctccggtc 361 gcaagctgtc tctgcaagag cggtcccagg gtgggctggc agccggtggc agcctggaca 421 tgaacggacg ctgcatctgc ccgtccctgc cctactcacc cgtcagctcc ccgcagtcct 481 cgcctcggct gccccggcgg ccgacagtgg agtctcacca cgtctccatc acgggtatgc 541 aggactgtgt gcagctgaat cagtataccc tgaaggatga aattggaaag ggctcctatg 601 gtgtcgtcaa gttggcctac aatgaaaatg acaataccta ctatgcaatg aaggtgctgt 661 ccaaaaagaa gctgatccgg caggccggct ttccacgtcg tcctccaccc cgaggcaccc 721 ggccagctcc tggaggctgc atccagccca ggggccccat tgagcaggtg taccaggaaa 781 ttgccatcct caagaagctg gaccacccca atgtggtgaa gctggtggag gtcctggatg 841 accccaatga ggaccatctg tacatggtgt tcgaactggt caaccaaggg cccgtgatgg 901 aagtgcccac cctcaaacca ctctctgaag accaggcccg tttctacttc caggatctga 961 tcaaaggcat cgagtactta cactaccaga agatcatcca ccgtgacatc aaaccttcca 1021 acctcctggt cggtgaagat gggcacatca agatcgctga ctttggtgtg agcaatgaat 1081 tcaagggcag tgacgcgctc ctctccaaca ccgtgggcac gcccgccttc atggcacccg 1141 agtcgctctc tgagacccgc aagatcttct ctgggaaggc cttggatgtt tgggccatgg 1201 gtgtgacact atactgcttt gtctttggcc agtgcccatt catggacgag cggatcatgt 1261 gtttacacag taagatcaag agtcaggccc tggaatttcc agaccagccc gacatagctg 1321 aggacttgaa ggacctgatc acccgtatgc tggacaagaa ccccgagtcg aggatcgtgg 1381 tgccggaaat caagctgcac cccTGGGTCA CGAGGCATGG GGCGGAGCCG TTGCCGTCGG 1441 AGGATGAGAA CTGCACGCTG GTCGAAGTGA CTGAAGAGGA GGTCGAGAAC TCAGTCAAAC 1501 ACATTCCCAG CTTGGCAACC GTGATCCTGG TGAAGACCAT GATACGTAAA CGCTCCTTTG 1561 GGAACCCATT CGAGGGCAGC CGGCGGGAGG AACGCTCACT GTCAGCGCCT GGAAACTTGC 1621 TCACGAAGCA AGGCAGCGAA GACAACCTCC AGGGCACCGA CCCGCCCCCC GTGGGGGAGG 1681 AGGAAGTGCT CTTGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1741 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1801 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TCATTGGCTC TTTCTTGGTC 1861 AGCCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt