Transcript: Mouse XM_006530251.3

PREDICTED: Mus musculus kinetochore associated 1 (Kntc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kntc1 (208628)
Length:
4510
CDS:
104..4318

Additional Resources:

NCBI RefSeq record:
XM_006530251.3
NBCI Gene record:
Kntc1 (208628)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530251.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251805 GCGAAGACATCGGTGGATATT pLKO_005 560 CDS 100% 13.200 18.480 N Kntc1 n/a
2 TRCN0000251803 ATGAAGCATCAGCGTTGATAA pLKO_005 4212 CDS 100% 13.200 10.560 N Kntc1 n/a
3 TRCN0000251806 GACTGCCCTTTCACCTAATAC pLKO_005 2460 CDS 100% 13.200 10.560 N Kntc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530251.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14945 pDONR223 66.5% 51.6% 6.6% None (many diffs) n/a
2 ccsbBroad304_14945 pLX_304 0% 51.6% 6.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV