Transcript: Mouse XM_006530418.3

PREDICTED: Mus musculus CAP-GLY domain containing linker protein 1 (Clip1), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clip1 (56430)
Length:
7940
CDS:
195..6458

Additional Resources:

NCBI RefSeq record:
XM_006530418.3
NBCI Gene record:
Clip1 (56430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530418.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430291 CTAGATTACCAGCACGAAATA pLKO_005 2193 CDS 100% 13.200 18.480 N Clip1 n/a
2 TRCN0000012231 CCCGAATAATGGAACTAGAAA pLKO.1 1720 CDS 100% 5.625 7.875 N Clip1 n/a
3 TRCN0000012232 CGCTGAATTTGCTGAGTTAAA pLKO.1 2150 CDS 100% 13.200 10.560 N Clip1 n/a
4 TRCN0000012229 CCGTAAATAAACTGCACCAAA pLKO.1 2476 CDS 100% 4.950 3.960 N Clip1 n/a
5 TRCN0000416505 CAAGCTCGACCACGCTAATAA pLKO_005 2012 CDS 100% 15.000 10.500 N Clip1 n/a
6 TRCN0000433353 AGAACGATCTGTACTCAATAA pLKO_005 5717 CDS 100% 13.200 9.240 N Clip1 n/a
7 TRCN0000012230 CCCGGATTTATCCAGTTTCTT pLKO.1 405 CDS 100% 5.625 3.938 N Clip1 n/a
8 TRCN0000012228 GCCAGCATTGGTGTGCAACTT pLKO.1 6517 3UTR 100% 4.950 3.465 N Clip1 n/a
9 TRCN0000296125 GAACCTTTAAAGGGCATATTT pLKO_005 528 CDS 100% 15.000 10.500 N CLIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530418.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15583 pDONR223 0% 14.3% 14.8% None (many diffs) n/a
2 ccsbBroad304_15583 pLX_304 0% 14.3% 14.8% V5 (many diffs) n/a
3 TRCN0000481010 CAGCTCACTCGGGGTAGTTAGGTT pLX_317 42.5% 14.3% 14.8% V5 (many diffs) n/a
Download CSV