Transcript: Mouse XM_006530504.1

PREDICTED: Mus musculus VPS33A CORVET/HOPS core subunit (Vps33a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vps33a (77573)
Length:
1285
CDS:
63..1064

Additional Resources:

NCBI RefSeq record:
XM_006530504.1
NBCI Gene record:
Vps33a (77573)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382515 CGCACAGTACTCACTACTAAA pLKO_005 209 CDS 100% 13.200 10.560 N Vps33a n/a
2 TRCN0000093356 CCTTTATTCATCGAGAAGAAT pLKO.1 460 CDS 100% 5.625 4.500 N Vps33a n/a
3 TRCN0000093357 GCTGATGTCAAGAACATCATT pLKO.1 282 CDS 100% 0.563 0.394 N Vps33a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08890 pDONR223 100% 48.2% 53.8% None (many diffs) n/a
2 ccsbBroad304_08890 pLX_304 0% 48.2% 53.8% V5 (many diffs) n/a
3 TRCN0000466165 CAGGCGTCCACGCTTTTATACCAT pLX_317 21.1% 48.2% 53.8% V5 (many diffs) n/a
Download CSV