Transcript: Mouse XM_006530772.1

PREDICTED: Mus musculus phospholipase A2, group XV (Pla2g15), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pla2g15 (192654)
Length:
2629
CDS:
137..847

Additional Resources:

NCBI RefSeq record:
XM_006530772.1
NBCI Gene record:
Pla2g15 (192654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076865 CACGCCAAACTCTTTCTACTA pLKO.1 1022 3UTR 100% 4.950 6.930 N Pla2g15 n/a
2 TRCN0000332213 CACGCCAAACTCTTTCTACTA pLKO_005 1022 3UTR 100% 4.950 6.930 N Pla2g15 n/a
3 TRCN0000076867 GCACAGAGTATCATTGCAGGA pLKO.1 1148 3UTR 100% 2.160 3.024 N Pla2g15 n/a
4 TRCN0000332211 GCACAGAGTATCATTGCAGGA pLKO_005 1148 3UTR 100% 2.160 3.024 N Pla2g15 n/a
5 TRCN0000076863 GCAGAGTTTGTGACCATCATT pLKO.1 1334 3UTR 100% 5.625 3.938 N Pla2g15 n/a
6 TRCN0000332147 GCAGAGTTTGTGACCATCATT pLKO_005 1334 3UTR 100% 5.625 3.938 N Pla2g15 n/a
7 TRCN0000076864 GTTATCATTGACTGCTGGATT pLKO.1 389 CDS 100% 4.950 3.465 N Pla2g15 n/a
8 TRCN0000332145 GTTATCATTGACTGCTGGATT pLKO_005 389 CDS 100% 4.950 3.465 N Pla2g15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11756 pDONR223 100% 20.6% 10.2% None (many diffs) n/a
2 ccsbBroad304_11756 pLX_304 0% 20.6% 10.2% V5 (many diffs) n/a
3 TRCN0000491698 TGACGGACTGTTAATTGCACCTGC pLX_317 42.2% 20.6% 10.2% V5 (many diffs) n/a
Download CSV