Transcript: Mouse XM_006530901.2

PREDICTED: Mus musculus enhancer of mRNA decapping 4 (Edc4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Edc4 (234699)
Length:
4794
CDS:
205..4431

Additional Resources:

NCBI RefSeq record:
XM_006530901.2
NBCI Gene record:
Edc4 (234699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257176 ATCTGCGGGACATACTCAAAC pLKO_005 248 CDS 100% 10.800 15.120 N Edc4 n/a
2 TRCN0000243535 CAACGAACAAACCTGGTATAC pLKO_005 383 CDS 100% 10.800 15.120 N Edc4 n/a
3 TRCN0000257155 CAAGTTCTGGCAGATCTATAT pLKO_005 1167 CDS 100% 13.200 10.560 N Edc4 n/a
4 TRCN0000192932 GCCAAATCAAGCAAGGCTTTA pLKO.1 1055 CDS 100% 10.800 7.560 N Edc4 n/a
5 TRCN0000243537 TGCTCTACTGATTGTGGTAAC pLKO_005 4569 3UTR 100% 6.000 4.200 N Edc4 n/a
6 TRCN0000192127 CAGGAGTCAATCTTAGCACAA pLKO.1 3859 CDS 100% 4.050 2.835 N Edc4 n/a
7 TRCN0000201696 GCACTAATTTGGCAGCAGCAA pLKO.1 3079 CDS 100% 2.640 1.848 N Edc4 n/a
8 TRCN0000243536 AGACTGGCCAGCACTAATTTG pLKO_005 3069 CDS 100% 13.200 7.920 N Edc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.