Transcript: Mouse XM_006530924.1

PREDICTED: Mus musculus alanyl-tRNA synthetase (Aars), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aars (234734)
Length:
3317
CDS:
46..2952

Additional Resources:

NCBI RefSeq record:
XM_006530924.1
NBCI Gene record:
Aars (234734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075966 GCTGCACATAGGAACGATATA pLKO.1 1764 CDS 100% 13.200 10.560 N Aars n/a
2 TRCN0000309808 GCTGCACATAGGAACGATATA pLKO_005 1764 CDS 100% 13.200 10.560 N Aars n/a
3 TRCN0000075964 CCTCGTGTTCATCCAGTATAA pLKO.1 693 CDS 100% 13.200 9.240 N Aars n/a
4 TRCN0000309809 CCTCGTGTTCATCCAGTATAA pLKO_005 693 CDS 100% 13.200 9.240 N Aars n/a
5 TRCN0000075967 GACCTCATCATGCTGGACATT pLKO.1 1426 CDS 100% 4.950 3.465 N Aars n/a
6 TRCN0000309739 GACCTCATCATGCTGGACATT pLKO_005 1426 CDS 100% 4.950 3.465 N Aars n/a
7 TRCN0000075965 GCGAGTGTTAGAGAAGACAAA pLKO.1 2562 CDS 100% 4.950 3.465 N Aars n/a
8 TRCN0000309738 GCGAGTGTTAGAGAAGACAAA pLKO_005 2562 CDS 100% 4.950 3.465 N Aars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.