Transcript: Mouse XM_006531435.3

PREDICTED: Mus musculus c-Maf inducing protein (Cmip), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cmip (74440)
Length:
4220
CDS:
234..2096

Additional Resources:

NCBI RefSeq record:
XM_006531435.3
NBCI Gene record:
Cmip (74440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346356 ACAGCGAGCCCAACCTTATTG pLKO_005 1042 CDS 100% 13.200 18.480 N Cmip n/a
2 TRCN0000376318 CTTTCGGAGCACCTCACTATG pLKO_005 1890 CDS 100% 10.800 15.120 N Cmip n/a
3 TRCN0000346430 AGGAACTGAAGTACGTGATTC pLKO_005 1255 CDS 100% 10.800 8.640 N Cmip n/a
4 TRCN0000370141 AGGAACTGAAGTACGTGATTC pLKO_005 1255 CDS 100% 10.800 8.640 N CMIP n/a
5 TRCN0000346355 CTAATTCTTAGAGCTTCATAT pLKO_005 2327 3UTR 100% 13.200 9.240 N Cmip n/a
6 TRCN0000376317 GTGGTTCAGAGGATCCTTAAA pLKO_005 570 CDS 100% 13.200 9.240 N Cmip n/a
7 TRCN0000346357 GGCCAAGCTTCCTAACCTAAA pLKO_005 2042 CDS 100% 10.800 7.560 N Cmip n/a
8 TRCN0000376316 GCTCTTCACCCAGGAGTATAT pLKO_005 626 CDS 100% 13.200 7.920 N Cmip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12708 pDONR223 100% 90.5% 98.7% None (many diffs) n/a
2 ccsbBroad304_12708 pLX_304 0% 90.5% 98.7% V5 (many diffs) n/a
3 TRCN0000481437 TGCCCATGACCGTGTGCATCAACT pLX_317 28.8% 90.5% 98.7% V5 (many diffs) n/a
Download CSV