Construct: ORF TRCN0000481437
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001810.1_s317c1
- Derived from:
- ccsbBroadEn_12708
- DNA Barcode:
- TGCCCATGACCGTGTGCATCAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CMIP (80790)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481437
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 80790 | CMIP | c-Maf inducing protein | XM_005256181.2 | 94.5% | 94.5% | 0_1ins102 |
2 | human | 80790 | CMIP | c-Maf inducing protein | XM_005256182.1 | 94.5% | 94.5% | 0_1ins102 |
3 | human | 80790 | CMIP | c-Maf inducing protein | XM_011523353.1 | 94.5% | 94.5% | 0_1ins102 |
4 | human | 80790 | CMIP | c-Maf inducing protein | XM_017023733.1 | 94.5% | 94.5% | 0_1ins102 |
5 | human | 80790 | CMIP | c-Maf inducing protein | NM_030629.3 | 90.9% | 90.4% | (many diffs) |
6 | human | 80790 | CMIP | c-Maf inducing protein | XM_005256179.5 | 83.8% | 83.3% | (many diffs) |
7 | human | 80790 | CMIP | c-Maf inducing protein | NM_198390.2 | 79.9% | 79.4% | (many diffs) |
8 | human | 80790 | CMIP | c-Maf inducing protein | XM_011523352.1 | 77.8% | 77.3% | (many diffs) |
9 | mouse | 74440 | Cmip | c-Maf inducing protein | XM_006531435.3 | 90.5% | 98.7% | (many diffs) |
10 | mouse | 74440 | Cmip | c-Maf inducing protein | XM_006531436.2 | 85.4% | 93.3% | (many diffs) |
11 | mouse | 74440 | Cmip | c-Maf inducing protein | NM_028941.1 | 81.5% | 88.6% | (many diffs) |
12 | mouse | 74440 | Cmip | c-Maf inducing protein | XM_006531434.3 | 80.1% | 87% | (many diffs) |
13 | mouse | 74440 | Cmip | c-Maf inducing protein | XM_011248527.2 | 78.3% | 85.1% | (many diffs) |
14 | mouse | 74440 | Cmip | c-Maf inducing protein | NM_001163262.1 | 72.3% | 78.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1926
- ORF length:
- 1860
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aagtgttgcc cagaaaaaga tttacaaata taagaaagtg ctgagtaacc 121 caagccgctg ggaagttgtc ttgaaagaga tccggaccct ggtggacatg gccctgacat 181 cccccctgca ggatgactcc atcaaccagg ccccactgga aatcgtctcg aaactgctct 241 cagagaacac aaacttgacc acccaggagc atgaaaacat cattgtggca atcgctcctt 301 tgctggaaaa caaccaccca ccaccagatc tctgtgaatt cttttgcaag cactgcagag 361 agcggccccg gtccatggtg gtcatcgagg tgttcacccc cgtggtgcag cgaatcctca 421 agcataacat ggactttggg aagtgcccgc gactgaggct gtttactcag gagtacatcc 481 ttgccttgaa cgagctcaac gcggggatgg aagtggtgaa gaagttcatt cagagcatgc 541 acggccccac agggcactgc ccccaccccc gggtcctgcc caacctggtg gccgtgtgcc 601 tggctgccat ctactcctgc tatgaagagt tcatcaacag ccgcgacaat tccccaagcc 661 tgaaggaaat ccggaacggc tgccagcagc cgtgcgaccg gaagcccact ttacctctgc 721 gccttctgca ccccagcccg gacctggtgt ctcaggaagc cacgctgtct gaggcccggc 781 tcaagtcggt ggtcgtggcc tccagtgaga tccacgtgga ggtggaacgc accagcactg 841 ccaagccggc gctgacggcc agcgcaggca acgacagcga gcccaacctc atcgactgcc 901 tcatggtcag ccccgcctgc agcaccatga gcatcgagct gggcccccag gccgaccgca 961 cgctcggctg ctacgtggaa atcctcaagc tgctgtcaga ctatgatgac tggagaccgt 1021 ctctggccag tttgcttcaa cccattccat tccccaaaga agctctcgca catgagaagt 1081 tcaccaagga actgaagtac gtgattcaga ggttcgccga agaccccagg caagaggtcc 1141 actcatgcct gctgagcgtg cgggccggca aagatggctg gttccagctc tacagccccg 1201 gaggggtggc ctgcgacgat gacggggagc tgttcgccag catggtgcac atcctcatgg 1261 gctcctgtta caagaccaaa aaattcctgc tctccctggc agaaaacaag ctgggtccct 1321 gcatgctcct ggcactgagg gggaaccaga ccatggtgga gatcctgtgc ttgatgctgg 1381 aatacaacat catcGACAAC AACGACACCC AACTGCAGAT CATCTCAACC CTGGAGAGCA 1441 CAGACGTGGG GAAGCGCATG TACGAGCAGC TGTGTGACCG GCAGCGGGAG CTGAAGGAGC 1501 TGCAAAGGAA AGGCGGGCCC ACCAGGCTAA CACTGCCCTC CAAGTCCACA GACGCTGACT 1561 TGGCTCGTTT GCTGAGCTCC GGCTCCTTCG GAAACCTGGA GAACCTCAGT TTGGCCTTCA 1621 CCAATGTAAC CAGTGCCTGC GCCGAGCACC TCATCAAACT GCCTTCGCTC AAGCAGCTGA 1681 ACCTGTGGTC CACTCAGTTT GGAGACGCTG GCCTTCGGCT CCTGTCGGAA CACCTCACCA 1741 TGCTCCAGGT GCTGAACCTG TGCGAGACCC CGGTCACAGA CGCTGGCCTG CTGGCCCTGA 1801 GCTCCATGAA GAGTCTCTGC AGTTTAAACA TGAACAGCAC CAAGCTCTCA GCTGACACCT 1861 ACGAAGATCT GAAGGCCAAG CTTCCCAATT TGAAGGAAGT GGACGTCCGC TACACCGAAG 1921 CCTGGTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1981 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2041 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGCCCATGA CCGTGTGCAT CAACTACGCG 2101 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt