Transcript: Mouse XM_006531610.3

PREDICTED: Mus musculus eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked (Eif2s3y), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eif2s3y (26908)
Length:
1488
CDS:
264..1145

Additional Resources:

NCBI RefSeq record:
XM_006531610.3
NBCI Gene record:
Eif2s3y (26908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197759 GTGACTATCAAGCCAACAATA pLKO.1 1113 CDS 100% 13.200 18.480 N Eif2s3y n/a
2 TRCN0000177113 GAAGCTTATGTGTAAACCAAT pLKO.1 647 CDS 100% 4.950 6.930 N Eif2s3y n/a
3 TRCN0000216106 CATAACAGTCTTAGAGATATT pLKO.1 1179 3UTR 100% 13.200 9.240 N Eif2s3y n/a
4 TRCN0000177232 GAAGGGAAGCTTATGTGTAAA pLKO.1 642 CDS 100% 13.200 9.240 N Eif2s3y n/a
5 TRCN0000216545 GATACATTTAATCTGCAATTC pLKO.1 1337 3UTR 100% 10.800 7.560 N Eif2s3y n/a
6 TRCN0000177358 GAACAGATACTTGCATTTGTA pLKO.1 339 CDS 100% 5.625 3.938 N Eif2s3y n/a
7 TRCN0000197899 GAAGTACTCATGGTGAACATA pLKO.1 930 CDS 100% 5.625 3.938 N Eif2s3y n/a
8 TRCN0000176559 CATTTGGATGAAACCAGGAAT pLKO.1 1153 3UTR 100% 4.950 3.465 N Eif2s3y n/a
9 TRCN0000176716 CCTGAGATATTCACAGAGTTA pLKO.1 819 CDS 100% 4.950 3.465 N Eif2s3y n/a
10 TRCN0000136286 GCTGTGAAGTTGATGACCTTA pLKO.1 529 CDS 100% 4.950 2.970 N EIF2S3 n/a
11 TRCN0000247274 TTGAGAAACACTGGCGTTTAA pLKO_005 1066 CDS 100% 13.200 6.600 Y Eif2s3x n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13849 pDONR223 100% 55.3% 59.9% None (many diffs) n/a
2 ccsbBroad304_13849 pLX_304 0% 55.3% 59.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467776 TCATTTAGTGTGGCCCTGCCGTAC pLX_317 33.8% 55.3% 59.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV