Transcript: Mouse XM_006531738.3

PREDICTED: Mus musculus splicing factor 1 (Sf1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sf1 (22668)
Length:
3294
CDS:
810..2516

Additional Resources:

NCBI RefSeq record:
XM_006531738.3
NBCI Gene record:
Sf1 (22668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531738.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109279 GCACGGATGGATAAAGAATAT pLKO.1 1728 CDS 100% 13.200 18.480 N Sf1 n/a
2 TRCN0000109276 GCGTAAAGATGGTCAGATGTT pLKO.1 1376 CDS 100% 4.950 6.930 N Sf1 n/a
3 TRCN0000287698 GCGTAAAGATGGTCAGATGTT pLKO_005 1376 CDS 100% 4.950 6.930 N Sf1 n/a
4 TRCN0000295166 GGTACAGGCTTTGGCTATTAA pLKO_005 2723 3UTR 100% 15.000 10.500 N Sf1 n/a
5 TRCN0000295110 CAACACGTGTGAGCGATAAAG pLKO_005 1207 CDS 100% 13.200 9.240 N Sf1 n/a
6 TRCN0000218954 GATAAAGCACGGATGGATAAA pLKO_005 1722 CDS 100% 13.200 9.240 N SF1 n/a
7 TRCN0000001073 AGGATAAAGCACGGATGGATA pLKO.1 1720 CDS 100% 4.950 3.465 N SF1 n/a
8 TRCN0000109275 CCCAAGACGAATATCCAGAAA pLKO.1 1237 CDS 100% 4.950 3.465 N Sf1 n/a
9 TRCN0000298367 CCCAAGACGAATATCCAGAAA pLKO_005 1237 CDS 100% 4.950 3.465 N Sf1 n/a
10 TRCN0000109277 CCGATGGAACCAAGACACAAT pLKO.1 869 CDS 100% 4.950 3.465 N Sf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531738.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01789 pDONR223 100% 88.8% 77.6% None (many diffs) n/a
2 ccsbBroad304_01789 pLX_304 0% 88.8% 77.6% V5 (many diffs) n/a
3 TRCN0000469808 GGGAACTTCGTCACAAGTTGTAGT pLX_317 26.7% 88.8% 77.6% V5 (many diffs) n/a
Download CSV