Transcript: Mouse XM_006531863.3

PREDICTED: Mus musculus zinc finger like protein 1 (Zfpl1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfpl1 (81909)
Length:
1306
CDS:
103..1035

Additional Resources:

NCBI RefSeq record:
XM_006531863.3
NBCI Gene record:
Zfpl1 (81909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313855 TCTGATCGATGAGGTGATAAG pLKO_005 507 CDS 100% 10.800 15.120 N Zfpl1 n/a
2 TRCN0000037381 GCCTGTATCAATGAACGTGCT pLKO.1 331 CDS 100% 2.160 3.024 N Zfpl1 n/a
3 TRCN0000313854 CTGCTTCGAACACCGAGTTAA pLKO_005 147 CDS 100% 13.200 9.240 N Zfpl1 n/a
4 TRCN0000313785 CCTCAGTCCTGAGACACTAAG pLKO_005 1122 3UTR 100% 10.800 7.560 N Zfpl1 n/a
5 TRCN0000037382 GCAGCACACAGTCATACACAT pLKO.1 684 CDS 100% 4.950 3.465 N Zfpl1 n/a
6 TRCN0000037379 GCTACAAGATAGTGACTACAA pLKO.1 231 CDS 100% 4.950 3.465 N Zfpl1 n/a
7 TRCN0000317368 GCTACAAGATAGTGACTACAA pLKO_005 231 CDS 100% 4.950 3.465 N Zfpl1 n/a
8 TRCN0000037383 GTATATGACACACGGGATGAT pLKO.1 742 CDS 100% 4.950 3.465 N Zfpl1 n/a
9 TRCN0000317369 GTATATGACACACGGGATGAT pLKO_005 742 CDS 100% 4.950 3.465 N Zfpl1 n/a
10 TRCN0000037380 CCTCTGATCGATGAGGTGATA pLKO.1 505 CDS 100% 4.950 2.970 N Zfpl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01790 pDONR223 100% 87.3% 92.2% None (many diffs) n/a
2 ccsbBroad304_01790 pLX_304 0% 87.3% 92.2% V5 (many diffs) n/a
3 TRCN0000475753 TGGAAATCGTACGTAAATCCCGTG pLX_317 34.7% 87.3% 92.2% V5 (many diffs) n/a
Download CSV