Transcript: Mouse XM_006532233.1

PREDICTED: Mus musculus growth factor receptor bound protein 7 (Grb7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grb7 (14786)
Length:
2005
CDS:
30..1637

Additional Resources:

NCBI RefSeq record:
XM_006532233.1
NBCI Gene record:
Grb7 (14786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305836 CACCTGCGCCTATCCTATTTG pLKO_005 1095 CDS 100% 13.200 18.480 N Grb7 n/a
2 TRCN0000097207 CTTCGCCAAGTATGAACTATT pLKO.1 578 CDS 100% 13.200 18.480 N Grb7 n/a
3 TRCN0000311421 AGCCGCTTCATCTTTCGTAAA pLKO_005 555 CDS 100% 10.800 15.120 N Grb7 n/a
4 TRCN0000097206 CGCCAAGTATGAACTATTCAA pLKO.1 581 CDS 100% 5.625 7.875 N Grb7 n/a
5 TRCN0000324719 CGCCAAGTATGAACTATTCAA pLKO_005 581 CDS 100% 5.625 7.875 N Grb7 n/a
6 TRCN0000097204 CTCTCTCAACCAGTGAAACAT pLKO.1 1766 3UTR 100% 5.625 3.938 N Grb7 n/a
7 TRCN0000324717 CTCTCTCAACCAGTGAAACAT pLKO_005 1766 3UTR 100% 5.625 3.938 N Grb7 n/a
8 TRCN0000097208 CCACCTTCACAGAAACCCATT pLKO.1 255 CDS 100% 4.050 2.835 N Grb7 n/a
9 TRCN0000324718 CCACCTTCACAGAAACCCATT pLKO_005 255 CDS 100% 4.050 2.835 N Grb7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00689 pDONR223 100% 85.2% 90.1% None (many diffs) n/a
2 ccsbBroad304_00689 pLX_304 0% 85.2% 90.1% V5 (many diffs) n/a
3 TRCN0000467298 TGACGTCCGTCCCAGACCGTCTGC pLX_317 22.2% 85.2% 90.1% V5 (many diffs) n/a
Download CSV