Transcript: Mouse XM_006532554.2

PREDICTED: Mus musculus potassium voltage-gated channel, subfamily H (eag-related), member 6 (Kcnh6), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnh6 (192775)
Length:
2626
CDS:
202..2529

Additional Resources:

NCBI RefSeq record:
XM_006532554.2
NBCI Gene record:
Kcnh6 (192775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068479 CGTAAGTTCCTGATTGCCAAT pLKO.1 280 CDS 100% 4.050 3.240 N Kcnh6 n/a
2 TRCN0000068480 CCCTCTGTCCAAGACAAGTAT pLKO.1 1570 CDS 100% 5.625 3.938 N Kcnh6 n/a
3 TRCN0000068481 CGGACACAGAATGTCACTGAA pLKO.1 844 CDS 100% 4.950 3.465 N Kcnh6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14289 pDONR223 100% 57.8% 61.8% None (many diffs) n/a
2 ccsbBroad304_14289 pLX_304 0% 57.8% 61.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468367 GATACGGCATTCACCCGCCGGGGG pLX_317 29% 57.8% 61.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV