Construct: ORF TRCN0000468367
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003257.1_s317c1
- Derived from:
- ccsbBroadEn_14289
- DNA Barcode:
- GATACGGCATTCACCCGCCGGGGG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- KCNH6 (81033)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468367
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_011525313.1 | 70.4% | 70.1% | (many diffs) |
2 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_011525311.1 | 68.9% | 68.7% | (many diffs) |
3 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_011525312.1 | 68.9% | 68.7% | (many diffs) |
4 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XR_934568.1 | 57.5% | (many diffs) | |
5 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_011525309.2 | 54.7% | 54.5% | (many diffs) |
6 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_011525308.2 | 54.5% | 54.3% | (many diffs) |
7 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_017025178.2 | 52.8% | 52.6% | (many diffs) |
8 | human | 81033 | KCNH6 | potassium voltage-gated cha... | NM_001278919.2 | 52.2% | 52% | (many diffs) |
9 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_017025177.1 | 52.2% | 52% | (many diffs) |
10 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_017025176.2 | 50.9% | 50.7% | (many diffs) |
11 | human | 81033 | KCNH6 | potassium voltage-gated cha... | NM_030779.4 | 50.3% | 50.2% | (many diffs) |
12 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_017025175.1 | 50.3% | 50.2% | (many diffs) |
13 | human | 81033 | KCNH6 | potassium voltage-gated cha... | NM_173092.3 | 46.7% | 46.4% | (many diffs) |
14 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_011525310.2 | 46.7% | 46.4% | (many diffs) |
15 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_017025179.2 | 45% | 44.7% | (many diffs) |
16 | human | 81033 | KCNH6 | potassium voltage-gated cha... | NM_001278920.2 | 39.4% | 39.2% | (many diffs) |
17 | human | 81033 | KCNH6 | potassium voltage-gated cha... | XM_017025180.2 | 37.9% | 37.8% | (many diffs) |
18 | human | 3757 | KCNH2 | potassium voltage-gated cha... | NM_001204798.2 | 35.4% | 31.9% | (many diffs) |
19 | human | 3757 | KCNH2 | potassium voltage-gated cha... | NM_172057.2 | 26% | 23.3% | (many diffs) |
20 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XM_006532558.3 | 73.5% | 76.6% | (many diffs) |
21 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XM_006532554.2 | 57.8% | 61.8% | (many diffs) |
22 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XM_006532553.1 | 57.7% | 61.7% | (many diffs) |
23 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XM_006532552.1 | 56.9% | 60.8% | (many diffs) |
24 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XM_006532550.2 | 50% | 53.4% | (many diffs) |
25 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XR_388374.2 | 48.8% | (many diffs) | |
26 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | NM_001037712.1 | 47.1% | 50.4% | (many diffs) |
27 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XR_388373.2 | 46.7% | (many diffs) | |
28 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XM_006532551.3 | 35.2% | 37.5% | (many diffs) |
29 | mouse | 192775 | Kcnh6 | potassium voltage-gated cha... | XR_001779926.1 | 23.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1569
- ORF length:
- 1503
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ggtccgcagg ggccacgtcg ctccccaaaa cacttacctg gacaccatca 121 tccgcaagtt cgagggccaa agtcggaagt tcctgattgc caatgctcag atggagaact 181 gcgccatcat ttactgcaac gacggcttct gcgaactctt cggctactcc cgagtggagg 241 tgatgcagca accctgcacc tgcgacttcc tcacaggccc caacacacca agcagcgccg 301 tgtcccgcct agcgcaggcc ctgctggggg ctgaggagtg caaggtggac atcctctact 361 accgcaagga tgcctccagc ttccgctgcc tggtagatgt ggtgcccgtg aagaacgagg 421 acggggctgt catcatgttc attctcaact tcgaggacct ggcccagctc ctggccaagt 481 gcagcagccg cagcttgtcc cagcgcctgt tgtcccagag cttcctgggc tccgagggct 541 ctcatggcag gccaggcgga ccagggccag gcacaggcag gggcaagtac aggaccatca 601 gccagatccc acagttcacg ctcaacttcg tggagttcaa cttggagaag caccgctcca 661 gctccaccac ggagattgag atcatcgcgc cccataaggt ggtggagcgg acacagaacg 721 tcactgagaa ggtcacccag gtcctgtccc tgggcgcgga tgtgctgccg gagtacaagc 781 tgcaggcgcc gcgcatccac cgctggacca tcctgcacta cagccccttc aaggccgtgt 841 gggactggct catcctgctg ctggtcatct acacggctgt cttcacgccc tactcagccg 901 ccttcctgct cagcgaccag gacgaatcac ggcgtggggc ctgcagctat acctgcagtc 961 ccctcactgt ggtggatctc atcgtggaca tcatgttcgt cgtggacatc gtcatcaact 1021 tccgcaccac ctatgtcaac accaatgatg aggtggtcag ccacccccgc cgcatcgccg 1081 tccactactt caagggctgg ttcctcattg acatggtggc cgccatccct ttcgacctcc 1141 TGATCTTCCG CACTGGCTCC GATGAGACCA CAACCCTGAT TGGGCTATTG AAGACAGCGC 1201 GGCTGCTGCG GCTGGTGCGC GTAGCACGGA AGCTGGACCG CTACTCTGAG TATGGGGCGG 1261 CTGTGCTCTT CTTGCTCATG TGCACCTTCG CGCTCATAGC GCACTGGCTG GCCTGCATCT 1321 GGTACGCCAT CGGCAATGTG GAGCGGCCCT ACCTAGAACA CAAGATCGGC TGGCTGGACA 1381 GCCTGGGTGT GCAGCTTGGC AAGCGCTACA ACGGCAGCGA CCCAGCCTCG GGCCCCTCGG 1441 TGCAGGACAA GTATGTCACA GCCCTCTACT TCACCTTCAG CAGCCTCACC AGCGTGGGCT 1501 TCGGCAATGT CTCGCCCAAC ACCAACTCCG AGAAGGTCTT CTCCATCTGC GTCATGCTCA 1561 TCCGGTTGTG AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT 1621 AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT 1681 TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGA TACGGCATTC ACCCGCCGGG 1741 GGACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt