Transcript: Mouse XM_006532742.2

PREDICTED: Mus musculus suppressor of Ty 4A (Supt4a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Supt4a (20922)
Length:
818
CDS:
215..514

Additional Resources:

NCBI RefSeq record:
XM_006532742.2
NBCI Gene record:
Supt4a (20922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081888 CGGCCTTAAGTCATCTCACTT pLKO.1 642 3UTR 100% 4.950 3.465 N Supt4a n/a
2 TRCN0000423621 GAAAGCAGCACATCGGCCTTA pLKO_005 629 3UTR 100% 4.050 2.835 N Supt4a n/a
3 TRCN0000417857 TCATTGCGATGATGAGTCCAG pLKO_005 339 CDS 100% 2.160 1.296 N Supt4a n/a
4 TRCN0000421139 GCAACAGAGAGATGGTTTATG pLKO_005 149 5UTR 100% 13.200 6.600 Y Supt4a n/a
5 TRCN0000019645 GCAGCGAGTCAGTAACTTTAA pLKO.1 382 CDS 100% 13.200 6.600 Y SUPT4H1 n/a
6 TRCN0000280371 GCAGCGAGTCAGTAACTTTAA pLKO_005 382 CDS 100% 13.200 6.600 Y SUPT4H1 n/a
7 TRCN0000435570 GCAGCGAGTCAGTAACTTTAA pLKO_005 382 CDS 100% 13.200 6.600 Y Supt4a n/a
8 TRCN0000081962 GTGTGACAATTGCGATGCATA pLKO.1 114 5UTR 100% 4.950 2.475 Y Supt4b n/a
9 TRCN0000081891 AGTGGCCTACAAATCCAGAGA pLKO.1 475 CDS 100% 2.640 1.320 Y Supt4a n/a
10 TRCN0000081958 CGATGATGAGTCCAGAGGACA pLKO.1 345 CDS 100% 2.640 1.320 Y Supt4b n/a
11 TRCN0000081890 CCAGCTCTTCATTTGATGGAA pLKO.1 176 5UTR 100% 3.000 1.500 Y Supt4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01623 pDONR223 100% 59.3% 50% None (many diffs) n/a
2 ccsbBroad304_01623 pLX_304 0% 59.3% 50% V5 (many diffs) n/a
3 TRCN0000491489 ACTTACCTAAAGCCTCTCCGCCGC pLX_317 90% 59.3% 50% V5 (many diffs) n/a
Download CSV