Transcript: Mouse XM_006532752.3

PREDICTED: Mus musculus UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 (B3gntl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
B3gntl1 (210004)
Length:
2765
CDS:
116..1189

Additional Resources:

NCBI RefSeq record:
XM_006532752.3
NBCI Gene record:
B3gntl1 (210004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250847 CGGACTCTACAGAGCGATATA pLKO_005 543 CDS 100% 13.200 18.480 N B3gntl1 n/a
2 TRCN0000258115 AGCACCCGACGAGTATCATAG pLKO_005 498 CDS 100% 10.800 15.120 N B3gntl1 n/a
3 TRCN0000250849 TCTACCGATACCACCTGTATG pLKO_005 786 CDS 100% 10.800 15.120 N B3gntl1 n/a
4 TRCN0000189459 CGTCTGTGACAGCAAACGTAT pLKO.1 1922 3UTR 100% 4.950 6.930 N B3gntl1 n/a
5 TRCN0000190003 GCTACGAAGACTCACAGGAAA pLKO.1 1017 CDS 100% 4.950 3.960 N B3gntl1 n/a
6 TRCN0000202454 GCCCATCTGCAACAGCTTAAT pLKO.1 1527 3UTR 100% 13.200 9.240 N B3gntl1 n/a
7 TRCN0000250846 GCTTTCAAGTCTGGCTATTAC pLKO_005 1431 3UTR 100% 13.200 9.240 N B3gntl1 n/a
8 TRCN0000250848 TCCCAGAGGAGTTGGATATTC pLKO_005 370 CDS 100% 13.200 9.240 N B3gntl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.