Transcript: Mouse XM_006532780.2

PREDICTED: Mus musculus T-box 4 (Tbx4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbx4 (21387)
Length:
3236
CDS:
224..1882

Additional Resources:

NCBI RefSeq record:
XM_006532780.2
NBCI Gene record:
Tbx4 (21387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433070 GATGACGAGACTACCTGTATC pLKO_005 1878 CDS 100% 10.800 15.120 N Tbx4 n/a
2 TRCN0000421031 GTCTTCTGACATGCAACTAAG pLKO_005 2064 3UTR 100% 10.800 15.120 N Tbx4 n/a
3 TRCN0000084570 GCCCACTTTAGTGTGTACAAT pLKO.1 1649 CDS 100% 5.625 4.500 N Tbx4 n/a
4 TRCN0000084569 GACCAAGTACATACTTCTCAT pLKO.1 568 CDS 100% 4.950 3.960 N Tbx4 n/a
5 TRCN0000425968 GTCATCCTTACAGTATCATTC pLKO_005 1825 CDS 100% 10.800 7.560 N Tbx4 n/a
6 TRCN0000084571 CAGCACTACCAGTATGAGAAT pLKO.1 1139 CDS 100% 4.950 3.465 N Tbx4 n/a
7 TRCN0000013451 GCAGACCATCGAGAACATCAA pLKO.1 421 CDS 100% 4.950 3.465 N TBX4 n/a
8 TRCN0000084572 TCGCTACAAGTTCTGTGACAA pLKO.1 613 CDS 100% 4.950 3.465 N Tbx4 n/a
9 TRCN0000415111 GCCATGCCAGGAAGACTTTAT pLKO_005 665 CDS 100% 13.200 7.920 N Tbx4 n/a
10 TRCN0000084568 CCCTTCTTATTGCAGTGAGGT pLKO.1 1381 CDS 100% 2.640 1.584 N Tbx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07430 pDONR223 100% 87.9% 92.3% None (many diffs) n/a
2 ccsbBroad304_07430 pLX_304 0% 87.9% 92.3% V5 (many diffs) n/a
Download CSV