Transcript: Mouse XM_006532840.3

PREDICTED: Mus musculus clathrin interactor 1 (Clint1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clint1 (216705)
Length:
3094
CDS:
221..2017

Additional Resources:

NCBI RefSeq record:
XM_006532840.3
NBCI Gene record:
Clint1 (216705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251824 CCAATAGAAGTTCGATATATA pLKO_005 3023 3UTR 100% 15.000 21.000 N Clint1 n/a
2 TRCN0000251823 ACGGTGACGACGAAGCATATC pLKO_005 986 CDS 100% 10.800 15.120 N Clint1 n/a
3 TRCN0000251826 TATGAACATGCCCGGTGTAAT pLKO_005 1789 CDS 100% 13.200 10.560 N Clint1 n/a
4 TRCN0000251825 CCCAGCAGCCATCGCTTAATA pLKO_005 1632 CDS 100% 15.000 10.500 N Clint1 n/a
5 TRCN0000251822 GGCAAGGATCAAGGTATAAAC pLKO_005 581 CDS 100% 13.200 9.240 N Clint1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02227 pDONR223 100% 85.9% 90.5% None (many diffs) n/a
2 ccsbBroad304_02227 pLX_304 0% 85.9% 90.5% V5 (many diffs) n/a
3 TRCN0000491415 TGCCAATCTTGTCCGAACTTAGGA pLX_317 16.7% 85.9% 90.5% V5 (many diffs) n/a
Download CSV