Transcript: Mouse XM_006532973.3

PREDICTED: Mus musculus ArfGAP with dual PH domains 2 (Adap2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adap2 (216991)
Length:
1260
CDS:
320..1186

Additional Resources:

NCBI RefSeq record:
XM_006532973.3
NBCI Gene record:
Adap2 (216991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532973.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145603 CAATGGATTCGAGCTAAGTAT pLKO.1 650 CDS 100% 5.625 7.875 N ADAP2 n/a
2 TRCN0000292161 CAATGGATTCGAGCTAAGTAT pLKO_005 650 CDS 100% 5.625 7.875 N ADAP2 n/a
3 TRCN0000305688 GAACGGAGGCTGCTCTATTAT pLKO_005 1227 3UTR 100% 15.000 10.500 N Adap2 n/a
4 TRCN0000106219 CCAGACATCAGCAAAGTTAAA pLKO.1 485 CDS 100% 13.200 9.240 N Adap2 n/a
5 TRCN0000323935 CCAGACATCAGCAAAGTTAAA pLKO_005 485 CDS 100% 13.200 9.240 N Adap2 n/a
6 TRCN0000106216 CCGCCTGCAATACCTGAAATT pLKO.1 1012 CDS 100% 13.200 9.240 N Adap2 n/a
7 TRCN0000106217 GCCTGGTCTTAAAGGAACAAT pLKO.1 633 CDS 100% 5.625 3.938 N Adap2 n/a
8 TRCN0000141961 GCCTGGTCTTAAAGGAACAAT pLKO.1 633 CDS 100% 5.625 3.938 N ADAP2 n/a
9 TRCN0000292159 GCCTGGTCTTAAAGGAACAAT pLKO_005 633 CDS 100% 5.625 3.938 N ADAP2 n/a
10 TRCN0000323877 GCCTGGTCTTAAAGGAACAAT pLKO_005 633 CDS 100% 5.625 3.938 N Adap2 n/a
11 TRCN0000106218 CCTCAACGTGAAAGCCAAGTT pLKO.1 565 CDS 100% 4.950 3.465 N Adap2 n/a
12 TRCN0000323934 CCTCAACGTGAAAGCCAAGTT pLKO_005 565 CDS 100% 4.950 3.465 N Adap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532973.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12276 pDONR223 100% 59.9% 60.2% None (many diffs) n/a
2 ccsbBroad304_12276 pLX_304 0% 59.9% 60.2% V5 (many diffs) n/a
3 TRCN0000478368 GGCCAGGCGATGAATATCAAATCT pLX_317 32.9% 59.9% 60.2% V5 (many diffs) n/a
Download CSV